RchiOBHm_Chr7g0241221

Cytochrome C oxidase, subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
67229107 .. 67229298
192 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21619

Sequence Viewer

Length: 192 bp
ATGGCTGGTCACAAGATTGCTCATGCCACATTGAAAGGACCAAACATTGTTAAGGAGAAAACCATCGGGCTGGTGCTTGGTTTGGCTACTGGAGGCCTTTGGAAAATGCATCACTGGAATGAGCAGAGGAAATTAAGGACATTTTATAACTTGCTGGAGAACGATGAAATCAGTGTTGTGGCCGAAGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.11

Weight (kDa)

8.14

Isoelectric Point (pI)

55.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 147
AcoI YGGCCR 1 cut(s) 180
AgsI TTSAA 1 cut(s) 34
AoxI GGCC 2 cut(s) 94, 180
AspS9I GGNCC 1 cut(s) 38
AvaII GGWCC 1 cut(s) 38
BccI CCATC 1 cut(s) 71
Bme18I GGWCC 1 cut(s) 38
BmgT120I GGNCC 1 cut(s) 38
BmsI GCATC 1 cut(s) 118
BpmI CTGGAG 2 cut(s) 111, 176
Bse1I ACTGG 2 cut(s) 94, 119
BseNI ACTGG 2 cut(s) 94, 119
BshFI GGCC 2 cut(s) 96, 182
BsnI GGCC 2 cut(s) 96, 182
BspANI GGCC 2 cut(s) 96, 182
BsrI ACTGG 2 cut(s) 94, 119
BstXI CCANNNNNNTGG 1 cut(s) 70
BsuRI GGCC 2 cut(s) 96, 182
BtsIMutI CAGTG 2 cut(s) 112, 178
Cfr13I GGNCC 1 cut(s) 38
CviAII CATG 1 cut(s) 23
CviJI RGCY 5 cut(s) 5, 70, 86, 96, 182
CviKI_1 RGCY 5 cut(s) 5, 70, 86, 96, 182
EaeI YGGCCR 1 cut(s) 180
Eco147I AGGCCT 1 cut(s) 96
Eco47I GGWCC 1 cut(s) 38
EcoT22I ATGCAT 1 cut(s) 111
FaeI CATG 1 cut(s) 26
FaiI YATR 2 cut(s) 24, 147
FatI CATG 1 cut(s) 22
GsuI CTGGAG 2 cut(s) 111, 176
HaeIII GGCC 2 cut(s) 96, 182
Hin1II CATG 1 cut(s) 26
HpyCH4V TGCA 1 cut(s) 109
Hsp92II CATG 1 cut(s) 26
LpnPI CCDG 4 cut(s) 56, 75, 100, 140
LweI GCATC 1 cut(s) 118
MaeIII GTNAC 1 cut(s) 8
MluCI AATT 1 cut(s) 131
MnlI CCTC 2 cut(s) 86, 120
Mph1103I ATGCAT 1 cut(s) 111
MseI TTAA 2 cut(s) 51, 134
MslI CAYNNNNRTG 1 cut(s) 117
NlaIII CATG 1 cut(s) 26
NmuCI GTSAC 1 cut(s) 8
NsiI ATGCAT 1 cut(s) 111
PceI AGGCCT 1 cut(s) 96
PsiI TTATAA 1 cut(s) 147
PspPI GGNCC 1 cut(s) 38
RseI CAYNNNNRTG 1 cut(s) 117
SaqAI TTAA 2 cut(s) 51, 134
Sau96I GGNCC 1 cut(s) 38
SfaNI GCATC 1 cut(s) 118
SinI GGWCC 1 cut(s) 38
SmiMI CAYNNNNRTG 1 cut(s) 117
Sse9I AATT 1 cut(s) 131
SseBI AGGCCT 1 cut(s) 96
StuI AGGCCT 1 cut(s) 96
TasI AATT 1 cut(s) 131
Tru1I TTAA 2 cut(s) 51, 134
Tru9I TTAA 2 cut(s) 51, 134
TscAI CASTG 2 cut(s) 119, 178
TseFI GTSAC 1 cut(s) 8
Tsp45I GTSAC 1 cut(s) 8
TspDTI ATGAA 1 cut(s) 180
TspRI CASTG 2 cut(s) 119, 178
VpaK11BI GGWCC 1 cut(s) 38
Zsp2I ATGCAT 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.