Rw5G020270

Cytochrome C oxidase, subunit

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Forward (+)
26729362 .. 26729532
171 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G020270.1

Sequence Viewer

Length: 171 bp
ATGAAAGGACTAAGTATTGTCAAGGAGATAATCATTGGCTCCGTACTTGGTTTGATTGCTAGAGGCCTTTGGAAAATGCATCAGTGGAATGAGCAGAGGAAAATAAGGACATTTTATGGCTTGGTGGAGAAAGGTATGGTGAATAATGTTTCTAGTAAAATGTTAAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.43

Weight (kDa)

10.45

Isoelectric Point (pI)

45.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 45
AoxI GGCC 1 cut(s) 64
AsuHPI GGTGA 1 cut(s) 151
BfaI CTAG 2 cut(s) 60, 153
BmiI GGNNCC 1 cut(s) 40
BmsI GCATC 1 cut(s) 88
BshFI GGCC 1 cut(s) 66
BsnI GGCC 1 cut(s) 66
BspANI GGCC 1 cut(s) 66
BspLI GGNNCC 1 cut(s) 40
BstDEI CTNAG 1 cut(s) 11
BsuRI GGCC 1 cut(s) 66
BtsIMutI CAGTG 1 cut(s) 89
Csp6I GTAC 1 cut(s) 44
CviJI RGCY 3 cut(s) 39, 66, 120
CviKI_1 RGCY 3 cut(s) 39, 66, 120
CviQI GTAC 1 cut(s) 44
DdeI CTNAG 1 cut(s) 11
Eco147I AGGCCT 1 cut(s) 66
EcoT22I ATGCAT 1 cut(s) 81
FaiI YATR 2 cut(s) 117, 137
FspBI CTAG 2 cut(s) 60, 153
HaeIII GGCC 1 cut(s) 66
HphI GGTGA 1 cut(s) 151
HpyCH4V TGCA 1 cut(s) 79
HpyF3I CTNAG 1 cut(s) 11
LmnI GCTCC 1 cut(s) 44
LweI GCATC 1 cut(s) 88
MaeI CTAG 2 cut(s) 60, 153
MnlI CCTC 2 cut(s) 56, 90
Mph1103I ATGCAT 1 cut(s) 81
MseI TTAA 1 cut(s) 164
NlaIV GGNNCC 1 cut(s) 40
NsiI ATGCAT 1 cut(s) 81
PceI AGGCCT 1 cut(s) 66
PspN4I GGNNCC 1 cut(s) 40
RsaI GTAC 1 cut(s) 45
RsaNI GTAC 1 cut(s) 44
SaqAI TTAA 1 cut(s) 164
SetI ASST 1 cut(s) 136
SfaNI GCATC 1 cut(s) 88
SgeI CNNG 5 cut(s) 34, 59, 72, 133, 165
SseBI AGGCCT 1 cut(s) 66
SspMI CTAG 2 cut(s) 60, 153
StuI AGGCCT 1 cut(s) 66
Tru1I TTAA 1 cut(s) 164
Tru9I TTAA 1 cut(s) 164
TscAI CASTG 1 cut(s) 89
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 31
TspRI CASTG 1 cut(s) 89
XspI CTAG 2 cut(s) 60, 153
Zsp2I ATGCAT 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.