RLG00000026466

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
OG0018084
Physical Location & Seq
Reverse (-)
3193090 .. 3193793
704 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000026466

Sequence Viewer

Length: 372 bp
ATGGAAGCCTATGACCGACACCGGCCTAAGATCACCAAGTTCAATTGGCGTCAGCAAGATGGTGATGGTGGTGCTATGAGTGAAAAAGGTCTAACGGCTTTGGGAAATGGGTGTCCTAAACTGGCTGGGGTTTGGGTTTCCGGGGAAGGAAGGGTGTTGCTATCTCTGCAATCCAAAACCCTCAAGGTATTGTACTTGGATGGTCGCTGGGACGTGTCAAACCGTACCATATTTGCTCTTGGTGAAAATTGTCGCAACTTAAGAAAGATACGATTCAAGGGTTTTTCTCGTGTAAACGTAACCTGGGATGCCCTTTCTGCCATTCGAGGTCCATACTTGACGTCTATTGATCTTGAGGGTGGTGATATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

124

Amino Acids

13.73

Weight (kDa)

9.64

Isoelectric Point (pI)

28.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018084)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g30123 FvH4_7g30140 FvH4_7g30140
rosa_laevigata RLG00000026466
rosa_multiflora Rmu_sc0000625.1_g000008
rosa_roxburghii Rroxscaffold_4G00280720
rosa_rugosa Rorug01G0406600
rosa_samantha Rh1BG385600 Rh1BG385700 Rh1DG416800 Rh1DG417000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 344
AcyI GRCGYC 2 cut(s) 49, 341
AfaI GTAC 2 cut(s) 194, 226
AflII CTTAAG 1 cut(s) 259
AflIII ACRYGT 1 cut(s) 213
AgsI TTSAA 2 cut(s) 43, 277
AjiI CACGTC 1 cut(s) 214
AjnI CCWGG 1 cut(s) 302
AoxI GGCC 1 cut(s) 23
AspS9I GGNCC 1 cut(s) 329
AsuC2I CCSGG 1 cut(s) 142
AsuHPI GGTGA 3 cut(s) 25, 74, 254
AvaII GGWCC 1 cut(s) 329
BauI CACGAG 1 cut(s) 288
BccI CCATC 3 cut(s) 53, 59, 194
BceAI ACGGC 1 cut(s) 111
BciT130I CCWGG 1 cut(s) 304
BcnI CCSGG 1 cut(s) 142
BfrI CTTAAG 1 cut(s) 259
Bme1390I CCNGG 2 cut(s) 142, 304
Bme18I GGWCC 1 cut(s) 329
BmgBI CACGTC 1 cut(s) 214
BmgT120I GGNCC 1 cut(s) 329
BmrFI CCNGG 2 cut(s) 142, 304
BmsI GCATC 1 cut(s) 298
BpuEI CTTGAG 1 cut(s) 167
BpuMI CCSGG 1 cut(s) 142
BsaHI GRCGYC 2 cut(s) 49, 341
BsaJI CCNNGG 2 cut(s) 141, 303
Bse118I RCCGGY 1 cut(s) 21
Bse1I ACTGG 1 cut(s) 126
BseBI CCWGG 1 cut(s) 304
BseDI CCNNGG 2 cut(s) 141, 303
BseGI GGATG 2 cut(s) 205, 313
BseNI ACTGG 1 cut(s) 126
BseYI CCCAGC 2 cut(s) 125, 207
BshFI GGCC 1 cut(s) 25
BsiSI CCGG 2 cut(s) 22, 141
BslFI GGGAC 1 cut(s) 224
BsmFI GGGAC 1 cut(s) 224
BsnI GGCC 1 cut(s) 25
Bsp143I GATC 2 cut(s) 30, 349
BspANI GGCC 1 cut(s) 25
BspTI CTTAAG 1 cut(s) 259
BsrFI RCCGGY 1 cut(s) 21
BsrI ACTGG 1 cut(s) 126
BssAI RCCGGY 1 cut(s) 21
BssECI CCNNGG 2 cut(s) 141, 303
BssMI GATC 2 cut(s) 30, 349
BssNI GRCGYC 2 cut(s) 49, 341
BssSI CACGAG 1 cut(s) 288
Bst2BI CACGAG 1 cut(s) 288
Bst2UI CCWGG 1 cut(s) 304
Bst4CI ACNGT 1 cut(s) 224
BstACI GRCGYC 2 cut(s) 49, 341
BstAFI CTTAAG 1 cut(s) 259
BstDEI CTNAG 1 cut(s) 27
BstF5I GGATG 2 cut(s) 205, 313
BstKTI GATC 2 cut(s) 33, 352
BstMBI GATC 2 cut(s) 30, 349
BstMWI GCNNNNNNNGC 2 cut(s) 166, 317
BstNI CCWGG 1 cut(s) 304
BstSCI CCNGG 2 cut(s) 140, 302
BsuRI GGCC 1 cut(s) 25
BtrI CACGTC 1 cut(s) 214
BtsCI GGATG 2 cut(s) 205, 313
Cfr10I RCCGGY 1 cut(s) 21
Cfr13I GGNCC 1 cut(s) 329
CseI GACGC 1 cut(s) 38
Csp6I GTAC 2 cut(s) 193, 225
CviJI RGCY 4 cut(s) 8, 25, 98, 125
CviKI_1 RGCY 4 cut(s) 8, 25, 98, 125
CviQI GTAC 2 cut(s) 193, 225
DdeI CTNAG 1 cut(s) 27
DpnI GATC 2 cut(s) 32, 351
DpnII GATC 2 cut(s) 30, 349
Eco47I GGWCC 1 cut(s) 329
EcoRII CCWGG 1 cut(s) 302
FaiI YATR 4 cut(s) 12, 77, 230, 334
FaqI GGGAC 1 cut(s) 224
FokI GGATG 2 cut(s) 212, 320
GsaI CCCAGC 2 cut(s) 129, 211
HaeIII GGCC 1 cut(s) 25
HapII CCGG 2 cut(s) 22, 141
HgaI GACGC 1 cut(s) 38
Hin1I GRCGYC 2 cut(s) 49, 341
HinfI GANTC 1 cut(s) 273
HpaII CCGG 2 cut(s) 22, 141
HphI GGTGA 3 cut(s) 25, 74, 254
Hpy166II GTNNAC 1 cut(s) 295
Hpy188III TCNNGA 1 cut(s) 353
Hpy8I GTNNAC 1 cut(s) 295
HpyAV CCTTC 2 cut(s) 140, 144
HpyCH4III ACNGT 1 cut(s) 224
HpyCH4IV ACGT 3 cut(s) 213, 297, 341
HpyCH4V TGCA 1 cut(s) 169
HpyF10VI GCNNNNNNNGC 2 cut(s) 166, 317
HpyF3I CTNAG 1 cut(s) 27
HpySE526I ACGT 3 cut(s) 213, 297, 341
Hsp92I GRCGYC 2 cut(s) 49, 341
Kzo9I GATC 2 cut(s) 30, 349
LpnPI CCDG 7 cut(s) 35, 107, 111, 154, 193, 289, 316
LweI GCATC 1 cut(s) 298
MaeII ACGT 3 cut(s) 213, 297, 341
MaeIII GTNAC 1 cut(s) 298
MalI GATC 2 cut(s) 32, 351
MboI GATC 2 cut(s) 30, 349
MfeI CAATTG 1 cut(s) 43
MluCI AATT 2 cut(s) 43, 247
MnlI CCTC 3 cut(s) 191, 320, 349
MseI TTAA 2 cut(s) 260, 370
MspCI CTTAAG 1 cut(s) 259
MspI CCGG 2 cut(s) 22, 141
MspR9I CCNGG 2 cut(s) 142, 304
MunI CAATTG 1 cut(s) 43
MvaI CCWGG 1 cut(s) 304
MwoI GCNNNNNNNGC 2 cut(s) 166, 317
NciI CCSGG 1 cut(s) 142
NdeII GATC 2 cut(s) 30, 349
PfeI GAWTC 1 cut(s) 273
Psp6I CCWGG 1 cut(s) 302
PspFI CCCAGC 2 cut(s) 125, 207
PspGI CCWGG 1 cut(s) 302
PspPI GGNCC 1 cut(s) 329
RsaI GTAC 2 cut(s) 194, 226
RsaNI GTAC 2 cut(s) 193, 225
SaqAI TTAA 2 cut(s) 260, 370
Sau3AI GATC 2 cut(s) 30, 349
Sau96I GGNCC 1 cut(s) 329
ScrFI CCNGG 2 cut(s) 142, 304
SetI ASST 7 cut(s) 91, 189, 216, 300, 305, 331, 344
SfaNI GCATC 1 cut(s) 298
SinI GGWCC 1 cut(s) 329
SmlI CTYRAG 3 cut(s) 182, 259, 353
SmoI CTYRAG 3 cut(s) 182, 259, 353
Sse9I AATT 2 cut(s) 43, 247
StyD4I CCNGG 2 cut(s) 140, 302
TaaI ACNGT 1 cut(s) 224
TaiI ACGT 3 cut(s) 216, 300, 344
TaqI TCGA 1 cut(s) 325
TaqII GACCGA 1 cut(s) 30
TasI AATT 2 cut(s) 43, 247
TatI WGTACW 1 cut(s) 192
TfiI GAWTC 1 cut(s) 273
Tru1I TTAA 2 cut(s) 260, 370
Tru9I TTAA 2 cut(s) 260, 370
Vha464I CTTAAG 1 cut(s) 259
VpaK11BI GGWCC 1 cut(s) 329
ZraI GACGTC 1 cut(s) 342
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.