Rmu_sc0000625.1_g000008

F-box LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000625.1
OG0018084
Physical Location & Seq
Forward (+)
40456 .. 40737
282 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000625.1_g000008.1.cds

Sequence Viewer

Length: 282 bp
atgtgtagcttggagctcctggaattgtctctcggtgtcaaacaaagatttactgatattgcaggtgttgctatctctgcaatccaaaccctcagggtattgaacctggatggtcgctgggacgtgtcaaaccgtaccatatttgctcttggaggaaattgtcgcaacttaagaaagatacgattcaagggtttttctcgtgtaaacgtaacctgggatgccctttctgccattcgaggtccatacttgacatctattgatcttgagggtggtgatatttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_6

Protein Analysis

93

Amino Acids

10.3

Weight (kDa)

9.3

Isoelectric Point (pI)

20.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018084)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g30123 FvH4_7g30140 FvH4_7g30140
rosa_laevigata RLG00000026466
rosa_multiflora Rmu_sc0000625.1_g000008
rosa_roxburghii Rroxscaffold_4G00280720
rosa_rugosa Rorug01G0406600
rosa_samantha Rh1BG385600 Rh1BG385700 Rh1DG416800 Rh1DG417000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 53
Acc36I ACCTGC 1 cut(s) 53
AfaI GTAC 1 cut(s) 136
AflII CTTAAG 1 cut(s) 169
AflIII ACRYGT 1 cut(s) 123
AgsI TTSAA 2 cut(s) 103, 187
AjiI CACGTC 1 cut(s) 124
AjnI CCWGG 3 cut(s) 18, 105, 212
AluBI AGCT 2 cut(s) 9, 16
AluI AGCT 2 cut(s) 9, 16
Alw21I GWGCWC 1 cut(s) 18
Alw26I GTCTC 1 cut(s) 33
AspS9I GGNCC 1 cut(s) 239
AvaII GGWCC 1 cut(s) 239
AxyI CCTNAGG 1 cut(s) 92
BanII GRGCYC 1 cut(s) 18
BauI CACGAG 1 cut(s) 198
Bbv12I GWGCWC 1 cut(s) 18
BccI CCATC 1 cut(s) 104
BciT130I CCWGG 3 cut(s) 20, 107, 214
BcoDI GTCTC 1 cut(s) 33
BfrI CTTAAG 1 cut(s) 169
BfuAI ACCTGC 1 cut(s) 53
Bme1390I CCNGG 3 cut(s) 20, 107, 214
Bme18I GGWCC 1 cut(s) 239
BmgBI CACGTC 1 cut(s) 124
BmgT120I GGNCC 1 cut(s) 239
BmrFI CCNGG 3 cut(s) 20, 107, 214
BmsI GCATC 1 cut(s) 208
BsaJI CCNNGG 1 cut(s) 213
Bse21I CCTNAGG 1 cut(s) 92
BseBI CCWGG 3 cut(s) 20, 107, 214
BseDI CCNNGG 1 cut(s) 213
BseGI GGATG 2 cut(s) 115, 223
BseMII CTCAG 1 cut(s) 106
BseYI CCCAGC 1 cut(s) 117
BsiHKAI GWGCWC 1 cut(s) 18
BslFI GGGAC 1 cut(s) 134
BsmAI GTCTC 1 cut(s) 33
BsmFI GGGAC 1 cut(s) 134
Bsp1286I GDGCHC 1 cut(s) 18
Bsp143I GATC 1 cut(s) 259
BspCNI CTCAG 1 cut(s) 105
BspMI ACCTGC 1 cut(s) 53
BspTI CTTAAG 1 cut(s) 169
BssECI CCNNGG 1 cut(s) 213
BssMI GATC 1 cut(s) 259
BssSI CACGAG 1 cut(s) 198
Bst2BI CACGAG 1 cut(s) 198
Bst2UI CCWGG 3 cut(s) 20, 107, 214
Bst4CI ACNGT 1 cut(s) 134
BstAFI CTTAAG 1 cut(s) 169
BstAPI GCANNNNNTGC 1 cut(s) 68
BstDEI CTNAG 1 cut(s) 92
BstF5I GGATG 2 cut(s) 115, 223
BstKTI GATC 1 cut(s) 262
BstMAI GTCTC 1 cut(s) 33
BstMBI GATC 1 cut(s) 259
BstMWI GCNNNNNNNGC 3 cut(s) 68, 77, 227
BstNI CCWGG 3 cut(s) 20, 107, 214
BstSCI CCNGG 3 cut(s) 18, 105, 212
Bsu36I CCTNAGG 1 cut(s) 92
BtrI CACGTC 1 cut(s) 124
BtsCI GGATG 2 cut(s) 115, 223
BveI ACCTGC 1 cut(s) 53
Cfr13I GGNCC 1 cut(s) 239
Csp6I GTAC 1 cut(s) 135
CviJI RGCY 2 cut(s) 9, 16
CviKI_1 RGCY 2 cut(s) 9, 16
CviQI GTAC 1 cut(s) 135
DdeI CTNAG 1 cut(s) 92
DpnI GATC 1 cut(s) 261
DpnII GATC 1 cut(s) 259
Ecl136II GAGCTC 1 cut(s) 16
Eco24I GRGCYC 1 cut(s) 18
Eco47I GGWCC 1 cut(s) 239
Eco53kI GAGCTC 1 cut(s) 16
Eco81I CCTNAGG 1 cut(s) 92
EcoICRI GAGCTC 1 cut(s) 16
EcoRII CCWGG 3 cut(s) 18, 105, 212
EcoT38I GRGCYC 1 cut(s) 18
FaiI YATR 2 cut(s) 140, 244
FaqI GGGAC 1 cut(s) 134
FokI GGATG 2 cut(s) 122, 230
FriOI GRGCYC 1 cut(s) 18
GsaI CCCAGC 1 cut(s) 121
HinfI GANTC 1 cut(s) 183
Hpy166II GTNNAC 1 cut(s) 205
Hpy188III TCNNGA 1 cut(s) 263
Hpy8I GTNNAC 1 cut(s) 205
HpyCH4III ACNGT 1 cut(s) 134
HpyCH4IV ACGT 2 cut(s) 123, 207
HpyCH4V TGCA 2 cut(s) 62, 80
HpyF10VI GCNNNNNNNGC 3 cut(s) 68, 77, 227
HpyF3I CTNAG 1 cut(s) 92
HpySE526I ACGT 2 cut(s) 123, 207
Kzo9I GATC 1 cut(s) 259
LmnI GCTCC 2 cut(s) 13, 21
LpnPI CCDG 9 cut(s) 5, 32, 48, 79, 92, 103, 119, 199, 226
LweI GCATC 1 cut(s) 208
MaeII ACGT 2 cut(s) 123, 207
MaeIII GTNAC 1 cut(s) 208
MalI GATC 1 cut(s) 261
MboI GATC 1 cut(s) 259
MhlI GDGCHC 1 cut(s) 18
MluCI AATT 2 cut(s) 23, 157
MnlI CCTC 4 cut(s) 101, 146, 230, 259
MseI TTAA 2 cut(s) 170, 280
MspCI CTTAAG 1 cut(s) 169
MspR9I CCNGG 3 cut(s) 20, 107, 214
MvaI CCWGG 3 cut(s) 20, 107, 214
MwoI GCNNNNNNNGC 3 cut(s) 68, 77, 227
NdeII GATC 1 cut(s) 259
PaqCI CACCTGC 1 cut(s) 53
PfeI GAWTC 1 cut(s) 183
PfoI TCCNGGA 1 cut(s) 18
Psp124BI GAGCTC 1 cut(s) 18
Psp6I CCWGG 3 cut(s) 18, 105, 212
PspFI CCCAGC 1 cut(s) 117
PspGI CCWGG 3 cut(s) 18, 105, 212
PspPI GGNCC 1 cut(s) 239
RsaI GTAC 1 cut(s) 136
RsaNI GTAC 1 cut(s) 135
SacI GAGCTC 1 cut(s) 18
SaqAI TTAA 2 cut(s) 170, 280
Sau3AI GATC 1 cut(s) 259
Sau96I GGNCC 1 cut(s) 239
ScrFI CCNGG 3 cut(s) 20, 107, 214
SduI GDGCHC 1 cut(s) 18
SetI ASST 8 cut(s) 11, 18, 67, 108, 126, 210, 215, 241
SfaNI GCATC 1 cut(s) 208
SinI GGWCC 1 cut(s) 239
SmlI CTYRAG 2 cut(s) 169, 263
SmoI CTYRAG 2 cut(s) 169, 263
Sse9I AATT 2 cut(s) 23, 157
SstI GAGCTC 1 cut(s) 18
StyD4I CCNGG 3 cut(s) 18, 105, 212
TaaI ACNGT 1 cut(s) 134
TaiI ACGT 2 cut(s) 126, 210
TaqI TCGA 1 cut(s) 235
TasI AATT 2 cut(s) 23, 157
TfiI GAWTC 1 cut(s) 183
Tru1I TTAA 2 cut(s) 170, 280
Tru9I TTAA 2 cut(s) 170, 280
Vha464I CTTAAG 1 cut(s) 169
VpaK11BI GGWCC 1 cut(s) 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.