RLG00000034117

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
OG0021369
Physical Location & Seq
Forward (+)
36982381 .. 36982872
492 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000034117

Sequence Viewer

Length: 411 bp
ATGTGCTTCCGCCGCAAGCAGCGGCGGTGCAATATTGCAGAGCTTGAATCCCACATGAGACAGCTTAGTTGGGAGCTAGAGGACTTGTATAATGGAAAAGGAACCAGGGCTGCCATTGAAGAGCTAAAAAGACCCGATCAGAGAGCAAACATGAAAGACAATTTAAGACGACTAATGGACGATGGCGCAAAGCTGGCTGAGGAGTTGTCATCGTTGCCTCCTCCTCGTGAACACCTCACCTTAAATTTTTACAAGATACGAATTGAGTGGTTGAACAATCAAGTGGAATTGTGGTCCAGATTTGTAAAGAGCGAACTTGCCTATATAGAACGAAAAGACAAAAAAGAAAGAACAAAGAAGAACGGCTTGTCTCAGATACATCTAGAATCCTTGTTCAATGGAGATCTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

137

Amino Acids

16.29

Weight (kDa)

9.32

Isoelectric Point (pI)

54.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021369)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0471561
rosa_laevigata RLG00000034117
rosa_multiflora Rmu_sc0001715.1_g000006
rosa_samantha Rh3DG180700 Rh4AG061600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 10, 13, 22, 25
AcsI RAATTY 1 cut(s) 244
AgsI TTSAA 4 cut(s) 47, 119, 274, 397
AjnI CCWGG 1 cut(s) 104
AluBI AGCT 5 cut(s) 43, 64, 76, 124, 193
AluI AGCT 5 cut(s) 43, 64, 76, 124, 193
Alw26I GTCTC 2 cut(s) 52, 375
ApeKI GCWGC 2 cut(s) 19, 110
ApoI RAATTY 1 cut(s) 244
AspLEI GCGC 1 cut(s) 188
AspS9I GGNCC 1 cut(s) 294
AsuHPI GGTGA 1 cut(s) 229
AvaII GGWCC 1 cut(s) 294
BauI CACGAG 1 cut(s) 225
BbvCI CCTCAGC 1 cut(s) 198
BbvI GCAGC 2 cut(s) 31, 97
BccI CCATC 1 cut(s) 176
BceAI ACGGC 1 cut(s) 379
BciT130I CCWGG 1 cut(s) 106
BcoDI GTCTC 2 cut(s) 52, 375
BfaI CTAG 2 cut(s) 77, 383
BglII AGATCT 1 cut(s) 403
BisI GCNGC 4 cut(s) 13, 20, 23, 111
BlsI GCNGC 4 cut(s) 14, 21, 24, 112
Bme1390I CCNGG 1 cut(s) 106
Bme18I GGWCC 1 cut(s) 294
BmgT120I GGNCC 1 cut(s) 294
BmiI GGNNCC 1 cut(s) 103
BmrFI CCNGG 1 cut(s) 106
Bpu10I CCTNAGC 1 cut(s) 198
BsaJI CCNNGG 1 cut(s) 105
BseBI CCWGG 1 cut(s) 106
BseDI CCNNGG 1 cut(s) 105
BseMII CTCAG 2 cut(s) 189, 386
BseRI GAGGAG 3 cut(s) 210, 213, 215
BseXI GCAGC 2 cut(s) 31, 97
BsmAI GTCTC 2 cut(s) 52, 375
Bsp143I GATC 2 cut(s) 136, 403
BspACI CCGC 4 cut(s) 10, 13, 22, 25
BspCNI CTCAG 2 cut(s) 190, 385
BspLI GGNNCC 1 cut(s) 103
BspQI GCTCTTC 1 cut(s) 114
BssECI CCNNGG 1 cut(s) 105
BssMI GATC 2 cut(s) 136, 403
BssSI CACGAG 1 cut(s) 225
Bst2BI CACGAG 1 cut(s) 225
Bst2UI CCWGG 1 cut(s) 106
Bst6I CTCTTC 1 cut(s) 114
BstC8I GCNNGC 2 cut(s) 17, 195
BstDEI CTNAG 3 cut(s) 65, 198, 372
BstHHI GCGC 1 cut(s) 188
BstKTI GATC 2 cut(s) 139, 406
BstMAI GTCTC 2 cut(s) 52, 375
BstMBI GATC 2 cut(s) 136, 403
BstMWI GCNNNNNNNGC 2 cut(s) 12, 194
BstNI CCWGG 1 cut(s) 106
BstSCI CCNGG 1 cut(s) 104
BstV1I GCAGC 2 cut(s) 31, 97
BstX2I RGATCY 1 cut(s) 403
BstYI RGATCY 1 cut(s) 403
Cac8I GCNNGC 2 cut(s) 17, 195
CfoI GCGC 1 cut(s) 188
Cfr13I GGNCC 1 cut(s) 294
CviAII CATG 2 cut(s) 55, 151
CviJI RGCY 8 cut(s) 43, 64, 76, 110, 124, 193, 197, 366
CviKI_1 RGCY 8 cut(s) 43, 64, 76, 110, 124, 193, 197, 366
DdeI CTNAG 3 cut(s) 65, 198, 372
DpnI GATC 2 cut(s) 138, 405
DpnII GATC 2 cut(s) 136, 403
Eam1104I CTCTTC 1 cut(s) 114
EarI CTCTTC 1 cut(s) 114
Eco47I GGWCC 1 cut(s) 294
EcoRII CCWGG 1 cut(s) 104
FaeI CATG 2 cut(s) 58, 154
FaiI YATR 6 cut(s) 56, 90, 152, 324, 326, 409
FalI AAGNNNNNCTT 2 cut(s) 350, 382
FatI CATG 2 cut(s) 54, 150
Fnu4HI GCNGC 4 cut(s) 13, 20, 23, 111
Fsp4HI GCNGC 4 cut(s) 13, 20, 23, 111
FspBI CTAG 2 cut(s) 77, 383
GlaI GCGC 1 cut(s) 187
GluI GCNGC 4 cut(s) 13, 20, 23, 111
HhaI GCGC 1 cut(s) 188
Hin1II CATG 2 cut(s) 58, 154
Hin6I GCGC 1 cut(s) 186
HinP1I GCGC 1 cut(s) 186
HinfI GANTC 2 cut(s) 47, 386
HphI GGTGA 1 cut(s) 229
Hpy166II GTNNAC 1 cut(s) 230
Hpy188I TCNGA 2 cut(s) 141, 375
Hpy188III TCNNGA 3 cut(s) 227, 297, 383
Hpy8I GTNNAC 1 cut(s) 230
HpyCH4V TGCA 2 cut(s) 30, 38
HpyF10VI GCNNNNNNNGC 2 cut(s) 12, 194
HpyF3I CTNAG 3 cut(s) 65, 198, 372
Hsp92II CATG 2 cut(s) 58, 154
HspAI GCGC 1 cut(s) 186
Kzo9I GATC 2 cut(s) 136, 403
LguI GCTCTTC 1 cut(s) 114
LmnI GCTCC 1 cut(s) 73
LpnPI CCDG 4 cut(s) 91, 118, 179, 310
Lsp1109I GCAGC 2 cut(s) 31, 97
MaeI CTAG 2 cut(s) 77, 383
MalI GATC 2 cut(s) 138, 405
MboI GATC 2 cut(s) 136, 403
MboII GAAGA 2 cut(s) 131, 370
MflI RGATCY 1 cut(s) 403
MluCI AATT 4 cut(s) 160, 244, 261, 287
MnlI CCTC 6 cut(s) 73, 193, 228, 231, 234, 245
MseI TTAA 2 cut(s) 164, 242
MspA1I CMGCKG 1 cut(s) 22
MspR9I CCNGG 1 cut(s) 106
MvaI CCWGG 1 cut(s) 106
MwoI GCNNNNNNNGC 2 cut(s) 12, 194
NdeII GATC 2 cut(s) 136, 403
NlaIII CATG 2 cut(s) 58, 154
NlaIV GGNNCC 1 cut(s) 103
PciSI GCTCTTC 1 cut(s) 114
PfeI GAWTC 2 cut(s) 47, 386
PkrI GCNGC 4 cut(s) 14, 21, 24, 112
Psp6I CCWGG 1 cut(s) 104
PspGI CCWGG 1 cut(s) 104
PspN4I GGNNCC 1 cut(s) 103
PspPI GGNCC 1 cut(s) 294
PsuI RGATCY 1 cut(s) 403
SapI GCTCTTC 1 cut(s) 114
SaqAI TTAA 2 cut(s) 164, 242
SatI GCNGC 4 cut(s) 13, 20, 23, 111
Sau3AI GATC 2 cut(s) 136, 403
Sau96I GGNCC 1 cut(s) 294
ScrFI CCNGG 1 cut(s) 106
SetI ASST 7 cut(s) 45, 66, 78, 126, 195, 237, 242
SinI GGWCC 1 cut(s) 294
Sse9I AATT 4 cut(s) 160, 244, 261, 287
SsiI CCGC 4 cut(s) 10, 13, 22, 25
SspI AATATT 1 cut(s) 34
SspMI CTAG 2 cut(s) 77, 383
StyD4I CCNGG 1 cut(s) 104
TasI AATT 4 cut(s) 160, 244, 261, 287
TauI GCSGC 2 cut(s) 15, 25
TfiI GAWTC 2 cut(s) 47, 386
Tru1I TTAA 2 cut(s) 164, 242
Tru9I TTAA 2 cut(s) 164, 242
TseI GCWGC 2 cut(s) 19, 110
TspDTI ATGAA 1 cut(s) 167
VpaK11BI GGWCC 1 cut(s) 294
XapI RAATTY 1 cut(s) 244
XbaI TCTAGA 1 cut(s) 382
XspI CTAG 2 cut(s) 77, 383
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.