Rh4AG061600

salt tolerance-like protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
13101750 .. 13109952
8203 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG061600.1

Sequence Viewer

Length: 222 bp
ATGTCGAAATGTGAAGCGAACATTCAATTGGCTGAGGAATGCAAAGTGGCGTCGTCGAGTGTAGCTGGGATGTCTTTTGCTGGTGGTTCTGCAGCTAGGTCTGTTCCACACTGGATGAGTTTATGGGATTCACTGATTTCGATCAAAGCTTTGAGTATATGGATAATGGATCGTCTAAGGCTGACTGCGGTAAACTTGGGGATTCTATATCATCAATTTTAA

Protein Analysis

73

Amino Acids

8.0

Weight (kDa)

7.84

Isoelectric Point (pI)

70.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021369)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0471561
rosa_laevigata RLG00000034117
rosa_multiflora Rmu_sc0001715.1_g000006
rosa_samantha Rh3DG180700 Rh4AG061600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 188
AclWI GGATC 1 cut(s) 177
AcyI GRCGYC 1 cut(s) 50
AgsI TTSAA 1 cut(s) 26
AjuI GAANNNNNNNTTGG 2 cut(s) 11, 43
AluBI AGCT 3 cut(s) 65, 95, 149
AluI AGCT 3 cut(s) 65, 95, 149
AlwI GGATC 1 cut(s) 177
ApeKI GCWGC 1 cut(s) 92
BbvCI CCTCAGC 1 cut(s) 33
BbvI GCAGC 1 cut(s) 104
BfaI CTAG 1 cut(s) 96
BfmI CTRYAG 1 cut(s) 90
BisI GCNGC 1 cut(s) 93
BlsI GCNGC 1 cut(s) 94
Bpu10I CCTNAGC 1 cut(s) 33
BsaBI GATNNNNATC 1 cut(s) 140
BsaHI GRCGYC 1 cut(s) 50
Bse1I ACTGG 1 cut(s) 116
Bse8I GATNNNNATC 1 cut(s) 140
BseGI GGATG 2 cut(s) 75, 120
BseJI GATNNNNATC 1 cut(s) 140
BseMII CTCAG 1 cut(s) 24
BseNI ACTGG 1 cut(s) 116
BseXI GCAGC 1 cut(s) 104
BseYI CCCAGC 1 cut(s) 65
BsmI GAATGC 1 cut(s) 44
Bsp143I GATC 2 cut(s) 141, 169
BspACI CCGC 1 cut(s) 188
BspCNI CTCAG 1 cut(s) 25
BspMAI CTGCAG 1 cut(s) 94
BspPI GGATC 1 cut(s) 177
BsrI ACTGG 1 cut(s) 116
BssMI GATC 2 cut(s) 141, 169
BssNI GRCGYC 1 cut(s) 50
BstACI GRCGYC 1 cut(s) 50
BstDEI CTNAG 2 cut(s) 33, 176
BstF5I GGATG 2 cut(s) 75, 120
BstKTI GATC 2 cut(s) 144, 172
BstMBI GATC 2 cut(s) 141, 169
BstSFI CTRYAG 1 cut(s) 90
BstV1I GCAGC 1 cut(s) 104
BtsCI GGATG 2 cut(s) 75, 120
BtsIMutI CAGTG 2 cut(s) 109, 131
CseI GACGC 1 cut(s) 39
CviJI RGCY 5 cut(s) 32, 65, 95, 149, 181
CviKI_1 RGCY 5 cut(s) 32, 65, 95, 149, 181
DdeI CTNAG 2 cut(s) 33, 176
DpnI GATC 2 cut(s) 143, 171
DpnII GATC 2 cut(s) 141, 169
FaiI YATR 4 cut(s) 124, 158, 160, 208
Fnu4HI GCNGC 1 cut(s) 93
FokI GGATG 2 cut(s) 82, 127
Fsp4HI GCNGC 1 cut(s) 93
FspBI CTAG 1 cut(s) 96
GluI GCNGC 1 cut(s) 93
GsaI CCCAGC 1 cut(s) 69
HgaI GACGC 1 cut(s) 39
Hin1I GRCGYC 1 cut(s) 50
HindIII AAGCTT 1 cut(s) 147
HinfI GANTC 2 cut(s) 128, 202
Hpy166II GTNNAC 1 cut(s) 193
Hpy8I GTNNAC 1 cut(s) 193
Hpy99I CGWCG 2 cut(s) 55, 58
HpyCH4V TGCA 2 cut(s) 42, 92
HpyF3I CTNAG 2 cut(s) 33, 176
Hsp92I GRCGYC 1 cut(s) 50
Kzo9I GATC 2 cut(s) 141, 169
LpnPI CCDG 3 cut(s) 51, 66, 97
Lsp1109I GCAGC 1 cut(s) 104
MaeI CTAG 1 cut(s) 96
MalI GATC 2 cut(s) 143, 171
MboI GATC 2 cut(s) 141, 169
MfeI CAATTG 1 cut(s) 26
MluCI AATT 2 cut(s) 26, 215
MnlI CCTC 1 cut(s) 28
MseI TTAA 1 cut(s) 220
MunI CAATTG 1 cut(s) 26
Mva1269I GAATGC 1 cut(s) 44
NdeII GATC 2 cut(s) 141, 169
PctI GAATGC 1 cut(s) 44
PfeI GAWTC 2 cut(s) 128, 202
PkrI GCNGC 1 cut(s) 94
PspFI CCCAGC 1 cut(s) 65
PstI CTGCAG 1 cut(s) 94
SaqAI TTAA 1 cut(s) 220
SatI GCNGC 1 cut(s) 93
Sau3AI GATC 2 cut(s) 141, 169
SetI ASST 4 cut(s) 67, 97, 101, 151
SfcI CTRYAG 1 cut(s) 90
SgeI CNNG 6 cut(s) 69, 78, 93, 108, 124, 208
Sse9I AATT 2 cut(s) 26, 215
SsiI CCGC 1 cut(s) 188
SspMI CTAG 1 cut(s) 96
TaqI TCGA 3 cut(s) 5, 56, 140
TasI AATT 2 cut(s) 26, 215
TfiI GAWTC 2 cut(s) 128, 202
Tru1I TTAA 1 cut(s) 220
Tru9I TTAA 1 cut(s) 220
TscAI CASTG 2 cut(s) 116, 138
TseI GCWGC 1 cut(s) 92
TspRI CASTG 2 cut(s) 116, 138
XspI CTAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.