Rmu_co7961776.1_g000001
TCP Family

transcription factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7961776.1
OG0023024
Physical Location & Seq
Forward (+)
1 .. 453
453 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7961776.1_g000001.1.cds

Sequence Viewer

Length: 218 bp
gactgcttcttcctccaccgctagagaaatcgtggaggctcaaggccaccggcccgaaggacagccacagcaaggtttgcaccaccaaaggccccagggatagcagcatcaagctcgtcgcccacaccgccattcaattctacgacatgcaggaccggcttggatacgaccagcctagcaaggttgtcgattggccacgcaggacacgcagaacgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TCP

Protein Analysis

71

Amino Acids

8.18

Weight (kDa)

10.1

Isoelectric Point (pI)

47.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023024)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co7961776.1_g000001 Rmu_sc0000082.1_g000087 Rmu_sc0000507.1_g000009 Rmu_ssc0000255.1_g000061

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 19, 128
AcoI YGGCCR 1 cut(s) 193
AfiI CCNNNNNNNGG 1 cut(s) 72
AgsI TTSAA 1 cut(s) 136
AjnI CCWGG 1 cut(s) 94
AluBI AGCT 1 cut(s) 114
AluI AGCT 1 cut(s) 114
AoxI GGCC 4 cut(s) 44, 51, 90, 193
ApeKI GCWGC 1 cut(s) 104
AspS9I GGNCC 3 cut(s) 52, 91, 153
AvaII GGWCC 1 cut(s) 153
BalI TGGCCA 1 cut(s) 195
BbvI GCAGC 1 cut(s) 116
BcgI CGANNNNNNTGC 4 cut(s) 96, 130, 168, 202
BciT130I CCWGG 1 cut(s) 96
BciVI GTATCC 1 cut(s) 157
BfaI CTAG 2 cut(s) 22, 176
BfuI GTATCC 1 cut(s) 157
BisI GCNGC 1 cut(s) 105
BlsI GCNGC 1 cut(s) 106
Bme1390I CCNGG 1 cut(s) 96
Bme18I GGWCC 1 cut(s) 153
BmgT120I GGNCC 3 cut(s) 52, 91, 153
BmiI GGNNCC 1 cut(s) 93
BmrFI CCNGG 1 cut(s) 96
BmsI GCATC 1 cut(s) 116
BpuEI CTTGAG 1 cut(s) 25
BsaJI CCNNGG 2 cut(s) 94, 95
Bsc4I CCNNNNNNNGG 1 cut(s) 72
Bse118I RCCGGY 2 cut(s) 49, 155
BseBI CCWGG 1 cut(s) 96
BseDI CCNNGG 2 cut(s) 94, 95
BseLI CCNNNNNNNGG 1 cut(s) 72
BseXI GCAGC 1 cut(s) 116
BshFI GGCC 4 cut(s) 46, 53, 92, 195
BsiSI CCGG 2 cut(s) 50, 156
BslI CCNNNNNNNGG 1 cut(s) 72
BsnI GGCC 4 cut(s) 46, 53, 92, 195
BspACI CCGC 2 cut(s) 19, 128
BspANI GGCC 4 cut(s) 46, 53, 92, 195
BspLI GGNNCC 1 cut(s) 93
BsrFI RCCGGY 2 cut(s) 49, 155
BssAI RCCGGY 2 cut(s) 49, 155
BssECI CCNNGG 2 cut(s) 94, 95
Bst2UI CCWGG 1 cut(s) 96
BstAPI GCANNNNNTGC 1 cut(s) 77
BstMWI GCNNNNNNNGC 4 cut(s) 77, 127, 156, 206
BstNI CCWGG 1 cut(s) 96
BstNSI RCATGY 1 cut(s) 150
BstSCI CCNGG 1 cut(s) 94
BstV1I GCAGC 1 cut(s) 116
BsuI GTATCC 1 cut(s) 157
BsuRI GGCC 4 cut(s) 46, 53, 92, 195
Cfr10I RCCGGY 2 cut(s) 49, 155
Cfr13I GGNCC 3 cut(s) 52, 91, 153
CviAII CATG 1 cut(s) 147
CviJI RGCY 9 cut(s) 39, 46, 53, 65, 92, 114, 159, 174, 195
CviKI_1 RGCY 9 cut(s) 39, 46, 53, 65, 92, 114, 159, 174, 195
EaeI YGGCCR 1 cut(s) 193
Eco47I GGWCC 1 cut(s) 153
EcoO109I RGGNCCY 1 cut(s) 91
EcoRII CCWGG 1 cut(s) 94
FaeI CATG 1 cut(s) 150
FaiI YATR 1 cut(s) 148
FatI CATG 1 cut(s) 146
Fnu4HI GCNGC 1 cut(s) 105
Fsp4HI GCNGC 1 cut(s) 105
FspBI CTAG 2 cut(s) 22, 176
GluI GCNGC 1 cut(s) 105
HaeIII GGCC 4 cut(s) 46, 53, 92, 195
HapII CCGG 2 cut(s) 50, 156
Hin1II CATG 1 cut(s) 150
HpaII CCGG 2 cut(s) 50, 156
Hpy99I CGWCG 1 cut(s) 121
HpyAV CCTTC 1 cut(s) 51
HpyCH4IV ACGT 1 cut(s) 214
HpyCH4V TGCA 2 cut(s) 80, 150
HpyF10VI GCNNNNNNNGC 4 cut(s) 77, 127, 156, 206
HpySE526I ACGT 1 cut(s) 214
Hsp92II CATG 1 cut(s) 150
LpnPI CCDG 7 cut(s) 63, 81, 108, 136, 169, 184, 186
Lsp1109I GCAGC 1 cut(s) 116
LweI GCATC 1 cut(s) 116
MaeI CTAG 2 cut(s) 22, 176
MaeII ACGT 1 cut(s) 214
MlsI TGGCCA 1 cut(s) 195
MluCI AATT 1 cut(s) 136
MluNI TGGCCA 1 cut(s) 195
MnlI CCTC 2 cut(s) 23, 29
Mox20I TGGCCA 1 cut(s) 195
MscI TGGCCA 1 cut(s) 195
Msp20I TGGCCA 1 cut(s) 195
MspI CCGG 2 cut(s) 50, 156
MspR9I CCNGG 1 cut(s) 96
MvaI CCWGG 1 cut(s) 96
MwoI GCNNNNNNNGC 4 cut(s) 77, 127, 156, 206
NlaIII CATG 1 cut(s) 150
NlaIV GGNNCC 1 cut(s) 93
NspI RCATGY 1 cut(s) 150
PasI CCCWGGG 1 cut(s) 95
PkrI GCNGC 1 cut(s) 106
Psp6I CCWGG 1 cut(s) 94
PspGI CCWGG 1 cut(s) 94
PspN4I GGNNCC 1 cut(s) 93
PspPI GGNCC 3 cut(s) 52, 91, 153
SatI GCNGC 1 cut(s) 105
Sau96I GGNCC 3 cut(s) 52, 91, 153
ScrFI CCNGG 1 cut(s) 96
SetI ASST 4 cut(s) 77, 116, 185, 217
SfaNI GCATC 1 cut(s) 116
SinI GGWCC 1 cut(s) 153
SmlI CTYRAG 1 cut(s) 40
SmoI CTYRAG 1 cut(s) 40
Sse9I AATT 1 cut(s) 136
SsiI CCGC 2 cut(s) 19, 128
SspMI CTAG 2 cut(s) 22, 176
StyD4I CCNGG 1 cut(s) 94
TaiI ACGT 1 cut(s) 217
TaqI TCGA 1 cut(s) 188
TasI AATT 1 cut(s) 136
TseI GCWGC 1 cut(s) 104
VpaK11BI GGWCC 1 cut(s) 153
XceI RCATGY 1 cut(s) 150
XspI CTAG 2 cut(s) 22, 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.