Rmu_sc0000082.1_g000087
TCP Family

transcription factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000082.1
Physical Location & Seq
Reverse (-)
300741 .. 301037
297 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000082.1_g000087.1.cds

Sequence Viewer

Length: 201 bp
atgggggagagccacaacaacttccaccaccgcacaacaacggccaccggcgggaaggaccgccacagcaaggtttgcaccaccaaaggtttgctcgtcgcccacaccgccattcaattctatgacatgcaggaccggcttggatatgaccggcctagcaaggccgtcgattggaggggtgagattggagctgtgatttga

Protein Analysis

66

Amino Acids

7.38

Weight (kDa)

8.98

Isoelectric Point (pI)

25.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0023024)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 31, 51, 61, 108
AcoI YGGCCR 1 cut(s) 42
AfiI CCNNNNNNNGG 3 cut(s) 51, 70, 171
AgsI TTSAA 1 cut(s) 116
AluBI AGCT 1 cut(s) 191
AluI AGCT 1 cut(s) 191
AoxI GGCC 3 cut(s) 42, 152, 162
AspS9I GGNCC 2 cut(s) 58, 133
AsuHPI GGTGA 1 cut(s) 191
AvaII GGWCC 2 cut(s) 58, 133
BceAI ACGGC 2 cut(s) 57, 149
BcgI CGANNNNNNTGC 2 cut(s) 148, 182
BfaI CTAG 1 cut(s) 156
Bme18I GGWCC 2 cut(s) 58, 133
BmgT120I GGNCC 2 cut(s) 58, 133
Bsc4I CCNNNNNNNGG 3 cut(s) 51, 70, 171
Bse118I RCCGGY 3 cut(s) 47, 135, 150
BseLI CCNNNNNNNGG 3 cut(s) 51, 70, 171
BshFI GGCC 3 cut(s) 44, 154, 164
BsiSI CCGG 3 cut(s) 48, 136, 151
BslI CCNNNNNNNGG 3 cut(s) 51, 70, 171
BsnI GGCC 3 cut(s) 44, 154, 164
BspACI CCGC 4 cut(s) 31, 51, 61, 108
BspANI GGCC 3 cut(s) 44, 154, 164
BsrFI RCCGGY 3 cut(s) 47, 135, 150
BssAI RCCGGY 3 cut(s) 47, 135, 150
BstAPI GCANNNNNTGC 1 cut(s) 75
BstMWI GCNNNNNNNGC 3 cut(s) 75, 107, 136
BstNSI RCATGY 1 cut(s) 130
BsuRI GGCC 3 cut(s) 44, 154, 164
Cfr10I RCCGGY 3 cut(s) 47, 135, 150
Cfr13I GGNCC 2 cut(s) 58, 133
CviAII CATG 1 cut(s) 127
CviJI RGCY 6 cut(s) 12, 44, 139, 154, 164, 191
CviKI_1 RGCY 6 cut(s) 12, 44, 139, 154, 164, 191
EaeI YGGCCR 1 cut(s) 42
Eco47I GGWCC 2 cut(s) 58, 133
FaeI CATG 1 cut(s) 130
FaiI YATR 3 cut(s) 123, 128, 147
FatI CATG 1 cut(s) 126
FauI CCCGC 1 cut(s) 44
FspBI CTAG 1 cut(s) 156
HaeIII GGCC 3 cut(s) 44, 154, 164
HapII CCGG 3 cut(s) 48, 136, 151
Hin1II CATG 1 cut(s) 130
HpaII CCGG 3 cut(s) 48, 136, 151
HphI GGTGA 1 cut(s) 191
Hpy99I CGWCG 2 cut(s) 101, 170
HpyAV CCTTC 1 cut(s) 49
HpyCH4V TGCA 2 cut(s) 78, 130
HpyF10VI GCNNNNNNNGC 3 cut(s) 75, 107, 136
Hsp92II CATG 1 cut(s) 130
LmnI GCTCC 1 cut(s) 188
LpnPI CCDG 4 cut(s) 61, 116, 149, 164
MaeI CTAG 1 cut(s) 156
MluCI AATT 1 cut(s) 116
MnlI CCTC 1 cut(s) 168
MspI CCGG 3 cut(s) 48, 136, 151
MwoI GCNNNNNNNGC 3 cut(s) 75, 107, 136
NlaIII CATG 1 cut(s) 130
NspI RCATGY 1 cut(s) 130
PspPI GGNCC 2 cut(s) 58, 133
Sau96I GGNCC 2 cut(s) 58, 133
SetI ASST 3 cut(s) 75, 91, 193
SgrAI CRCCGGYG 1 cut(s) 47
SinI GGWCC 2 cut(s) 58, 133
Sse9I AATT 1 cut(s) 116
SsiI CCGC 4 cut(s) 31, 51, 61, 108
SspMI CTAG 1 cut(s) 156
TaqI TCGA 1 cut(s) 168
TasI AATT 1 cut(s) 116
VpaK11BI GGWCC 2 cut(s) 58, 133
XceI RCATGY 1 cut(s) 130
XspI CTAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.