Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co7997612.1

Orthogroup ID

OG0020454

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 266

Gene Structure 266 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co7997612.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 266 bp

tatgcgatgatgggtcaagtcttgctgttggctatgtagatggtgatataatgttttgggatatatcaactgctgagtctaccaaggatcatagatctaaaaagttagctaacaatgttgcgaagctagagttatcatcagatgacaagagactccctgtcatagttttacactggtctgcaaataggttaagtcatcatcctaggggccaactctttgtttatggaggtgaaggaattgggtctgaagaagttctcacggtatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000149 GO:0002791 GO:0002792 GO:0002793 GO:0003674 GO:0005096 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005886 GO:0008047 GO:0008150 GO:0010646 GO:0010648 GO:0010817 GO:0016020 GO:0017016 GO:0017137 GO:0017157 GO:0019899 GO:0019905 GO:0023051 GO:0023057 GO:0030234 GO:0030695 GO:0031267 GO:0032879 GO:0032880 GO:0033500 GO:0042592 GO:0042593 GO:0043085 GO:0043087 GO:0043547 GO:0044093 GO:0044424 GO:0044464 GO:0046676 GO:0046883 GO:0046888 GO:0048518 GO:0048519 GO:0048522 GO:0048523 GO:0048878 GO:0050708 GO:0050709 GO:0050714 GO:0050789 GO:0050790 GO:0050794 GO:0050796 GO:0051020 GO:0051046 GO:0051047 GO:0051048 GO:0051049 GO:0051050 GO:0051051 GO:0051222 GO:0051223 GO:0051224 GO:0051336 GO:0051345 GO:0060589 GO:0060627 GO:0065007 GO:0065008 GO:0065009 GO:0070201 GO:0071944 GO:0090087 GO:0090276 GO:0090278 GO:0098772 GO:1903530 GO:1903531 GO:1903532 GO:1904950 GO:1904951

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ANAPC4_WD40 Synaptobrevin

Protein Analysis

87

Amino Acids

9.54

Weight (kDa)

5.41

Isoelectric Point (pI)

25.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020454)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr0c22g0500601 RchiOBHm_Chr7g0206651
rosa_multiflora	Rmu_co7997612.1_g000001
rosa_samantha	Rh2AG219000 Rh2CG561800 Rh2DG225200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	79
AclWI	GGATC	1 cut(s)	95
AcuI	CTGAAG	1 cut(s)	266
AhdI	GACNNNNNGTC	1 cut(s)	157
AluBI	AGCT	2 cut(s)	109, 126
AluI	AGCT	2 cut(s)	109, 126
Alw26I	GTCTC	1 cut(s)	144
AlwI	GGATC	1 cut(s)	95
AoxI	GGCC	1 cut(s)	207
Asp700I	GAANNNNTTC	1 cut(s)	251
AspA2I	CCTAGG	1 cut(s)	202
AspS9I	GGNCC	1 cut(s)	207
AsuHPI	GGTGA	2 cut(s)	55, 241
AvrII	CCTAGG	1 cut(s)	202
BccI	CCATC	2 cut(s)	4, 34
BcoDI	GTCTC	1 cut(s)	144
BfaI	CTAG	2 cut(s)	127, 203
BglII	AGATCT	1 cut(s)	94
BlnI	CCTAGG	1 cut(s)	202
BmeRI	GACNNNNNGTC	1 cut(s)	157
BmgT120I	GGNCC	1 cut(s)	207
BmiI	GGNNCC	1 cut(s)	208
BsaJI	CCNNGG	2 cut(s)	83, 202
Bse1I	ACTGG	1 cut(s)	178
BseDI	CCNNGG	2 cut(s)	83, 202
BseGI	GGATG	1 cut(s)	198
BseMII	CTCAG	1 cut(s)	65
BseNI	ACTGG	1 cut(s)	178
BshFI	GGCC	1 cut(s)	209
BsmAI	GTCTC	1 cut(s)	144
BsnI	GGCC	1 cut(s)	209
Bsp143I	GATC	2 cut(s)	87, 94
BspANI	GGCC	1 cut(s)	209
BspCNI	CTCAG	1 cut(s)	66
BspLI	GGNNCC	1 cut(s)	208
BspPI	GGATC	1 cut(s)	95
BsrI	ACTGG	1 cut(s)	178
BssECI	CCNNGG	2 cut(s)	83, 202
BssMI	GATC	2 cut(s)	87, 94
BssT1I	CCWWGG	2 cut(s)	83, 202
Bst4CI	ACNGT	1 cut(s)	261
BstDEI	CTNAG	1 cut(s)	74
BstF5I	GGATG	1 cut(s)	198
BstKTI	GATC	2 cut(s)	90, 97
BstMAI	GTCTC	1 cut(s)	144
BstMBI	GATC	2 cut(s)	87, 94
BstX2I	RGATCY	1 cut(s)	94
BstYI	RGATCY	1 cut(s)	94
BsuRI	GGCC	1 cut(s)	209
BtgZI	GCGATG	1 cut(s)	20
BtsCI	GGATG	1 cut(s)	198
BtsIMutI	CAGTG	1 cut(s)	171
Cfr13I	GGNCC	1 cut(s)	207
CviJI	RGCY	4 cut(s)	32, 109, 126, 209
CviKI_1	RGCY	4 cut(s)	32, 109, 126, 209
DdeI	CTNAG	1 cut(s)	74
DpnI	GATC	2 cut(s)	89, 96
DpnII	GATC	2 cut(s)	87, 94
DriI	GACNNNNNGTC	1 cut(s)	157
Eam1105I	GACNNNNNGTC	1 cut(s)	157
Eco130I	CCWWGG	2 cut(s)	83, 202
Eco57I	CTGAAG	1 cut(s)	266
EcoT14I	CCWWGG	2 cut(s)	83, 202
ErhI	CCWWGG	2 cut(s)	83, 202
FaiI	YATR	8 cut(s)	3, 35, 49, 64, 92, 163, 224, 264
FblI	GTMKAC	1 cut(s)	79
FokI	GGATG	1 cut(s)	185
FspBI	CTAG	2 cut(s)	127, 203
HaeIII	GGCC	1 cut(s)	209
HinfI	GANTC	2 cut(s)	76, 152
HphI	GGTGA	2 cut(s)	55, 241
Hpy166II	GTNNAC	1 cut(s)	80
Hpy188I	TCNGA	2 cut(s)	141, 246
Hpy8I	GTNNAC	1 cut(s)	80
HpyAV	CCTTC	1 cut(s)	226
HpyCH4III	ACNGT	1 cut(s)	261
HpyCH4V	TGCA	1 cut(s)	181
HpyF3I	CTNAG	1 cut(s)	74
Kzo9I	GATC	2 cut(s)	87, 94
LpnPI	CCDG	2 cut(s)	159, 170
MaeI	CTAG	2 cut(s)	127, 203
MalI	GATC	2 cut(s)	89, 96
MboI	GATC	2 cut(s)	87, 94
MboII	GAAGA	1 cut(s)	259
MflI	RGATCY	1 cut(s)	94
MluCI	AATT	1 cut(s)	236
MlyI	GAGTC	2 cut(s)	85, 146
MnlI	CCTC	1 cut(s)	220
MroXI	GAANNNNTTC	1 cut(s)	251
MseI	TTAA	1 cut(s)	190
NdeII	GATC	2 cut(s)	87, 94
NlaIV	GGNNCC	1 cut(s)	208
PdmI	GAANNNNTTC	1 cut(s)	251
PleI	GAGTC	2 cut(s)	84, 146
PpsI	GAGTC	2 cut(s)	84, 146
PspN4I	GGNNCC	1 cut(s)	208
PspPI	GGNCC	1 cut(s)	207
PsuI	RGATCY	1 cut(s)	94
SaqAI	TTAA	1 cut(s)	190
Sau3AI	GATC	2 cut(s)	87, 94
Sau96I	GGNCC	1 cut(s)	207
SchI	GAGTC	2 cut(s)	85, 146
SetI	ASST	4 cut(s)	111, 128, 190, 231
SgeI	CNNG	8 cut(s)	29, 34, 96, 139, 159, 169, 186, 215
Sse9I	AATT	1 cut(s)	236
SspMI	CTAG	2 cut(s)	127, 203
StyI	CCWWGG	2 cut(s)	83, 202
TaaI	ACNGT	1 cut(s)	261
TasI	AATT	1 cut(s)	236
Tru1I	TTAA	1 cut(s)	190
Tru9I	TTAA	1 cut(s)	190
TscAI	CASTG	1 cut(s)	178
TspRI	CASTG	1 cut(s)	178
XmaJI	CCTAGG	1 cut(s)	202
XmiI	GTMKAC	1 cut(s)	79
XmnI	GAANNNNTTC	1 cut(s)	251
XspI	CTAG	2 cut(s)	127, 203

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.