Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8010648.1

Orthogroup ID

OG0019932

Physical Location & Seq

Genomic Coordinates Reverse (-)

17 .. 283

Gene Structure 267 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8010648.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 267 bp

atgggttctggtctgcggaacatgcttcatttaactaatgcatccgattatggtgcttcattgcaattcactaaggatgatgctggttctttggtctcatctgagcagcatgaagaagcaataattacagggtccgtgctggtcggaccttcgtcgcatctcttctgggttgggatacccactttgatcaacttgatgctaaatacagatgagaagagggagaagataactgatgtcttgagagttgcctatgatgagcatctttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

88

Amino Acids

9.66

Weight (kDa)

4.91

Isoelectric Point (pI)

27.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019932)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0042551
rosa_multiflora	Rmu_co8010648.1_g000001
rosa_rugosa	Rorug05G0201500 Rorug05G0201900
rosa_samantha	Rh5BG292000 Rh5DG301800
rosa_wichuraiana	Rw5G026680

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	16
Alw26I	GTCTC	1 cut(s)	100
ApeKI	GCWGC	1 cut(s)	106
AspS9I	GGNCC	2 cut(s)	132, 146
AvaII	GGWCC	2 cut(s)	132, 146
BbvI	GCAGC	1 cut(s)	118
BcgI	CGANNNNNNTGC	2 cut(s)	35, 69
BciVI	GTATCC	1 cut(s)	168
BclI	TGATCA	1 cut(s)	186
BcoDI	GTCTC	1 cut(s)	100
BfuI	GTATCC	1 cut(s)	168
BisI	GCNGC	1 cut(s)	107
BlsI	GCNGC	1 cut(s)	108
Bme18I	GGWCC	2 cut(s)	132, 146
BmgT120I	GGNCC	2 cut(s)	132, 146
BmiI	GGNNCC	1 cut(s)	133
BmsI	GCATC	4 cut(s)	50, 70, 166, 186
BoxI	GACNNNNGTC	1 cut(s)	151
BpuEI	CTTGAG	1 cut(s)	259
BsaBI	GATNNNNATC	1 cut(s)	258
BsaI	GGTCTC	1 cut(s)	100
Bse3DI	GCAATG	1 cut(s)	59
Bse8I	GATNNNNATC	1 cut(s)	258
BseGI	GGATG	2 cut(s)	41, 82
BseJI	GATNNNNATC	1 cut(s)	258
BseMI	GCAATG	1 cut(s)	59
BseMII	CTCAG	1 cut(s)	93
BseXI	GCAGC	1 cut(s)	118
BsmAI	GTCTC	1 cut(s)	100
Bso31I	GGTCTC	1 cut(s)	100
Bsp143I	GATC	1 cut(s)	186
BspACI	CCGC	1 cut(s)	16
BspCNI	CTCAG	1 cut(s)	94
BspLI	GGNNCC	1 cut(s)	133
BspTNI	GGTCTC	1 cut(s)	100
BsrDI	GCAATG	1 cut(s)	59
BssMI	GATC	1 cut(s)	186
Bst6I	CTCTTC	2 cut(s)	167, 209
BstDEI	CTNAG	2 cut(s)	72, 102
BstF5I	GGATG	2 cut(s)	41, 82
BstKTI	GATC	1 cut(s)	189
BstMAI	GTCTC	1 cut(s)	100
BstMBI	GATC	1 cut(s)	186
BstMWI	GCNNNNNNNGC	1 cut(s)	22
BstNSI	RCATGY	1 cut(s)	25
BstPAI	GACNNNNGTC	1 cut(s)	151
BstV1I	GCAGC	1 cut(s)	118
BsuI	GTATCC	1 cut(s)	168
BtsCI	GGATG	2 cut(s)	41, 82
Cfr13I	GGNCC	2 cut(s)	132, 146
CviAII	CATG	2 cut(s)	22, 110
DdeI	CTNAG	2 cut(s)	72, 102
DpnI	GATC	1 cut(s)	188
DpnII	GATC	1 cut(s)	186
Eam1104I	CTCTTC	2 cut(s)	167, 209
EarI	CTCTTC	2 cut(s)	167, 209
Eco31I	GGTCTC	1 cut(s)	100
Eco47I	GGWCC	2 cut(s)	132, 146
EcoT22I	ATGCAT	1 cut(s)	43
FaeI	CATG	2 cut(s)	25, 113
FaiI	YATR	4 cut(s)	23, 51, 111, 252
FatI	CATG	2 cut(s)	21, 109
FbaI	TGATCA	1 cut(s)	186
Fnu4HI	GCNGC	1 cut(s)	107
FokI	GGATG	2 cut(s)	28, 89
Fsp4HI	GCNGC	1 cut(s)	107
GluI	GCNGC	1 cut(s)	107
Hin1II	CATG	2 cut(s)	25, 113
Hpy188I	TCNGA	3 cut(s)	46, 103, 146
Hpy188III	TCNNGA	1 cut(s)	238
Hpy99I	CGWCG	1 cut(s)	157
HpyAV	CCTTC	1 cut(s)	159
HpyCH4V	TGCA	2 cut(s)	41, 64
HpyF10VI	GCNNNNNNNGC	1 cut(s)	22
HpyF3I	CTNAG	2 cut(s)	72, 102
Hsp92II	CATG	2 cut(s)	25, 113
Ksp22I	TGATCA	1 cut(s)	186
Kzo9I	GATC	1 cut(s)	186
LpnPI	CCDG	4 cut(s)	69, 114, 125, 151
Lsp1109I	GCAGC	1 cut(s)	118
LweI	GCATC	4 cut(s)	50, 70, 166, 186
MalI	GATC	1 cut(s)	188
MboI	GATC	1 cut(s)	186
MboII	GAAGA	4 cut(s)	125, 154, 226, 235
MluCI	AATT	2 cut(s)	65, 123
MmeI	TCCRAC	1 cut(s)	124
MnlI	CCTC	1 cut(s)	210
Mph1103I	ATGCAT	1 cut(s)	43
MseI	TTAA	1 cut(s)	32
MwoI	GCNNNNNNNGC	1 cut(s)	22
NdeII	GATC	1 cut(s)	186
NlaIII	CATG	2 cut(s)	25, 113
NlaIV	GGNNCC	1 cut(s)	133
NsiI	ATGCAT	1 cut(s)	43
NspI	RCATGY	1 cut(s)	25
PkrI	GCNGC	1 cut(s)	108
PshAI	GACNNNNGTC	1 cut(s)	151
PspN4I	GGNNCC	1 cut(s)	133
PspPI	GGNCC	2 cut(s)	132, 146
SaqAI	TTAA	1 cut(s)	32
SatI	GCNGC	1 cut(s)	107
Sau3AI	GATC	1 cut(s)	186
Sau96I	GGNCC	2 cut(s)	132, 146
SetI	ASST	1 cut(s)	151
SfaNI	GCATC	4 cut(s)	50, 70, 166, 186
SinI	GGWCC	2 cut(s)	132, 146
SmlI	CTYRAG	1 cut(s)	238
SmoI	CTYRAG	1 cut(s)	238
Sse9I	AATT	2 cut(s)	65, 123
SsiI	CCGC	1 cut(s)	16
TasI	AATT	2 cut(s)	65, 123
Tru1I	TTAA	1 cut(s)	32
Tru9I	TTAA	1 cut(s)	32
TseI	GCWGC	1 cut(s)	106
TspDTI	ATGAA	3 cut(s)	17, 48, 126
TspGWI	ACGGA	1 cut(s)	124
VpaK11BI	GGWCC	2 cut(s)	132, 146
XceI	RCATGY	1 cut(s)	25
Zsp2I	ATGCAT	1 cut(s)	43

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.