Rmu_co8014206.1_g000001
ERF Family

belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8014206.1
Physical Location & Seq
Forward (+)
1 .. 481
481 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8014206.1_g000001.1.cds

Sequence Viewer

Length: 374 bp
ttgttggtttttgcagtgatcaagatgattatgaggttgtgaggaaagtagggagagggaaatacagcgaggtctttgaaggtatcaatgtcaataccaatgagcgatgcataatcaaaatcctcaagcctgtgaagaagaagaagattaagagggagattaagattctgcagaacctttgtgggggcccaaatgtggtcaagcttcttgatattgttcgagatcagcactcgaaaactccgagcttgattttcgagtatgttaatagtacagatttcaaagttctgtaccccacactgactgattatgacattcgctactacatatatgagctcctcaaggtaatgttattgcatgtggtttatgcttcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

123

Amino Acids

14.33

Weight (kDa)

9.07

Isoelectric Point (pI)

13.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020831)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G50000 AT5G67380 AT5G67380
rosa_laevigata RLG00000029453
rosa_multiflora Rmu_co8014206.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 270, 289
AfiI CCNNNNNNNGG 2 cut(s) 183, 195
AgsI TTSAA 2 cut(s) 79, 279
AluBI AGCT 3 cut(s) 204, 245, 333
AluI AGCT 3 cut(s) 204, 245, 333
Alw21I GWGCWC 1 cut(s) 335
AoxI GGCC 1 cut(s) 186
ApaI GGGCCC 1 cut(s) 190
AspS9I GGNCC 2 cut(s) 186, 187
BaeGI GKGCMC 1 cut(s) 190
BanII GRGCYC 2 cut(s) 190, 335
Bbv12I GWGCWC 1 cut(s) 335
BclI TGATCA 1 cut(s) 18
BfmI CTRYAG 1 cut(s) 169
BmgT120I GGNCC 2 cut(s) 186, 187
BmiI GGNNCC 2 cut(s) 187, 188
BmsI GCATC 1 cut(s) 97
BpuEI CTTGAG 2 cut(s) 109, 322
Bsc4I CCNNNNNNNGG 2 cut(s) 183, 195
BseLI CCNNNNNNNGG 2 cut(s) 183, 195
BseRI GAGGAG 1 cut(s) 325
BseSI GKGCMC 1 cut(s) 190
BshFI GGCC 1 cut(s) 188
BsiHKAI GWGCWC 1 cut(s) 335
BslI CCNNNNNNNGG 2 cut(s) 183, 195
BsnI GGCC 1 cut(s) 188
Bsp120I GGGCCC 1 cut(s) 186
Bsp1286I GDGCHC 2 cut(s) 190, 335
Bsp143I GATC 2 cut(s) 18, 222
BspANI GGCC 1 cut(s) 188
BspLI GGNNCC 2 cut(s) 187, 188
BspMAI CTGCAG 1 cut(s) 173
BssMI GATC 2 cut(s) 18, 222
BstKTI GATC 2 cut(s) 21, 225
BstMBI GATC 2 cut(s) 18, 222
BstNSI RCATGY 1 cut(s) 358
BstSFI CTRYAG 1 cut(s) 169
BstSLI GKGCMC 1 cut(s) 190
BsuRI GGCC 1 cut(s) 188
BtgZI GCGATG 1 cut(s) 120
BtsI GCAGTG 1 cut(s) 21
BtsIMutI CAGTG 2 cut(s) 21, 295
Cfr13I GGNCC 2 cut(s) 186, 187
Csp6I GTAC 2 cut(s) 269, 288
CviAII CATG 1 cut(s) 355
CviJI RGCY 5 cut(s) 129, 188, 204, 245, 333
CviKI_1 RGCY 5 cut(s) 129, 188, 204, 245, 333
CviQI GTAC 2 cut(s) 269, 288
DpnI GATC 2 cut(s) 20, 224
DpnII GATC 2 cut(s) 18, 222
Ecl136II GAGCTC 1 cut(s) 333
Eco24I GRGCYC 2 cut(s) 190, 335
Eco53kI GAGCTC 1 cut(s) 333
EcoICRI GAGCTC 1 cut(s) 333
EcoO109I RGGNCCY 1 cut(s) 186
EcoT22I ATGCAT 1 cut(s) 112
EcoT38I GRGCYC 2 cut(s) 190, 335
FaeI CATG 1 cut(s) 358
FaiI YATR 9 cut(s) 32, 112, 260, 308, 325, 327, 329, 356, 365
FatI CATG 1 cut(s) 354
FbaI TGATCA 1 cut(s) 18
FriOI GRGCYC 2 cut(s) 190, 335
HaeIII GGCC 1 cut(s) 188
Hin1II CATG 1 cut(s) 358
HindIII AAGCTT 1 cut(s) 202
HinfI GANTC 1 cut(s) 165
Hpy188I TCNGA 1 cut(s) 242
Hpy188III TCNNGA 4 cut(s) 22, 208, 220, 371
HpyAV CCTTC 1 cut(s) 73
HpyCH4V TGCA 4 cut(s) 14, 110, 171, 354
Hsp92II CATG 1 cut(s) 358
Ksp22I TGATCA 1 cut(s) 18
Kzo9I GATC 2 cut(s) 18, 222
LmnI GCTCC 1 cut(s) 338
LpnPI CCDG 1 cut(s) 143
LweI GCATC 1 cut(s) 97
MalI GATC 2 cut(s) 20, 224
MboI GATC 2 cut(s) 18, 222
MboII GAAGA 4 cut(s) 147, 150, 153, 156
MhlI GDGCHC 2 cut(s) 190, 335
MnlI CCTC 7 cut(s) 27, 35, 49, 63, 133, 146, 346
Mph1103I ATGCAT 1 cut(s) 112
MseI TTAA 3 cut(s) 149, 161, 263
NdeII GATC 2 cut(s) 18, 222
NlaIII CATG 1 cut(s) 358
NlaIV GGNNCC 2 cut(s) 187, 188
NsiI ATGCAT 1 cut(s) 112
NspI RCATGY 1 cut(s) 358
PcsI WCGNNNNNNNCGW 1 cut(s) 238
PfeI GAWTC 1 cut(s) 165
Psp124BI GAGCTC 1 cut(s) 335
PspN4I GGNNCC 2 cut(s) 187, 188
PspOMI GGGCCC 1 cut(s) 186
PspPI GGNCC 2 cut(s) 186, 187
PstI CTGCAG 1 cut(s) 173
RsaI GTAC 2 cut(s) 270, 289
RsaNI GTAC 2 cut(s) 269, 288
SacI GAGCTC 1 cut(s) 335
SaqAI TTAA 3 cut(s) 149, 161, 263
Sau3AI GATC 2 cut(s) 18, 222
Sau96I GGNCC 2 cut(s) 186, 187
SduI GDGCHC 2 cut(s) 190, 335
SetI ASST 8 cut(s) 38, 74, 84, 179, 206, 247, 335, 344
SfaNI GCATC 1 cut(s) 97
SfcI CTRYAG 1 cut(s) 169
SmlI CTYRAG 2 cut(s) 124, 337
SmoI CTYRAG 2 cut(s) 124, 337
SstI GAGCTC 1 cut(s) 335
TaqI TCGA 3 cut(s) 219, 232, 254
TatI WGTACW 1 cut(s) 268
TfiI GAWTC 1 cut(s) 165
Tru1I TTAA 3 cut(s) 149, 161, 263
Tru9I TTAA 3 cut(s) 149, 161, 263
TscAI CASTG 2 cut(s) 21, 302
TspRI CASTG 2 cut(s) 21, 302
XceI RCATGY 1 cut(s) 358
Zsp2I ATGCAT 1 cut(s) 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.