Rmu_co8043834.1_g000001

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8043834.1
Physical Location & Seq
Reverse (-)
2 .. 383
382 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8043834.1_g000001.1.cds

Sequence Viewer

Length: 267 bp
atgaagatgctggcctcagccaaaaatgggggagtacaacaaaaacatgaaaggaaggattttctgcagttcctcttggagaacaataataatcatgaagatggttcaacatcgtttacagtgcaacaactgaagggcttgctcatggatatcgtggtgggtggaactgacactacggcaacaatagtggaatgggttctgactgagctgatgcagcacccagaagaaatgataagagttcaagaagaactaacacaaattgtgggg
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

10.04

Weight (kDa)

4.84

Isoelectric Point (pI)

22.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020993)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G12334
rosa_chinensis RchiOBHm_Chr4g0420041
rosa_multiflora Rmu_co8043834.1_g000001
rosa_samantha Rh4BG225000 Rh7DG199000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 152
AfaI GTAC 1 cut(s) 36
AfiI CCNNNNNNNGG 1 cut(s) 27
AgsI TTSAA 2 cut(s) 108, 242
AluBI AGCT 1 cut(s) 208
AluI AGCT 1 cut(s) 208
AoxI GGCC 1 cut(s) 12
ApeKI GCWGC 1 cut(s) 214
Asp700I GAANNNNTTC 1 cut(s) 195
BbvCI CCTCAGC 1 cut(s) 16
BbvI GCAGC 1 cut(s) 226
BccI CCATC 1 cut(s) 95
BceAI ACGGC 1 cut(s) 192
BfmI CTRYAG 1 cut(s) 65
BisI GCNGC 1 cut(s) 215
BlsI GCNGC 1 cut(s) 216
BmsI GCATC 1 cut(s) 201
Bpu10I CCTNAGC 1 cut(s) 16
Bsc4I CCNNNNNNNGG 1 cut(s) 27
BseLI CCNNNNNNNGG 1 cut(s) 27
BseMII CTCAG 2 cut(s) 30, 195
BseXI GCAGC 1 cut(s) 226
BshFI GGCC 1 cut(s) 14
BslI CCNNNNNNNGG 1 cut(s) 27
BsnI GGCC 1 cut(s) 14
BspANI GGCC 1 cut(s) 14
BspCNI CTCAG 2 cut(s) 29, 196
BspHI TCATGA 1 cut(s) 94
BspMAI CTGCAG 1 cut(s) 69
Bst4CI ACNGT 1 cut(s) 121
BstC8I GCNNGC 2 cut(s) 12, 140
BstDEI CTNAG 2 cut(s) 16, 204
BstMWI GCNNNNNNNGC 1 cut(s) 214
BstSFI CTRYAG 1 cut(s) 65
BstV1I GCAGC 1 cut(s) 226
BsuRI GGCC 1 cut(s) 14
BtsIMutI CAGTG 1 cut(s) 126
Cac8I GCNNGC 2 cut(s) 12, 140
CciI TCATGA 1 cut(s) 94
Csp6I GTAC 1 cut(s) 35
CspCI CAANNNNNGTGG 2 cut(s) 168, 203
CviAII CATG 3 cut(s) 47, 95, 145
CviJI RGCY 4 cut(s) 14, 20, 138, 208
CviKI_1 RGCY 4 cut(s) 14, 20, 138, 208
CviQI GTAC 1 cut(s) 35
DdeI CTNAG 2 cut(s) 16, 204
Eco32I GATATC 1 cut(s) 151
Eco57I CTGAAG 1 cut(s) 152
EcoRV GATATC 1 cut(s) 151
FaeI CATG 3 cut(s) 50, 98, 148
FaiI YATR 3 cut(s) 48, 96, 146
FatI CATG 3 cut(s) 46, 94, 144
Fnu4HI GCNGC 1 cut(s) 215
Fsp4HI GCNGC 1 cut(s) 215
GluI GCNGC 1 cut(s) 215
HaeIII GGCC 1 cut(s) 14
Hin1II CATG 3 cut(s) 50, 98, 148
Hpy166II GTNNAC 1 cut(s) 117
Hpy188I TCNGA 1 cut(s) 201
Hpy188III TCNNGA 2 cut(s) 95, 242
Hpy8I GTNNAC 1 cut(s) 117
HpyAV CCTTC 2 cut(s) 49, 127
HpyCH4III ACNGT 1 cut(s) 121
HpyCH4V TGCA 3 cut(s) 67, 124, 214
HpyF10VI GCNNNNNNNGC 1 cut(s) 214
HpyF3I CTNAG 2 cut(s) 16, 204
Hsp92II CATG 3 cut(s) 50, 98, 148
LpnPI CCDG 1 cut(s) 234
Lsp1109I GCAGC 1 cut(s) 226
LweI GCATC 1 cut(s) 201
MboII GAAGA 4 cut(s) 16, 110, 236, 257
MluCI AATT 1 cut(s) 258
MnlI CCTC 2 cut(s) 25, 83
MroXI GAANNNNTTC 1 cut(s) 195
MslI CAYNNNNRTG 1 cut(s) 99
MwoI GCNNNNNNNGC 1 cut(s) 214
NlaIII CATG 3 cut(s) 50, 98, 148
PagI TCATGA 1 cut(s) 94
PdmI GAANNNNTTC 1 cut(s) 195
PkrI GCNGC 1 cut(s) 216
PsrI GAACNNNNNNTAC 2 cut(s) 157, 189
PstI CTGCAG 1 cut(s) 69
RsaI GTAC 1 cut(s) 36
RsaNI GTAC 1 cut(s) 35
RseI CAYNNNNRTG 1 cut(s) 99
SatI GCNGC 1 cut(s) 215
SetI ASST 1 cut(s) 210
SfaNI GCATC 1 cut(s) 201
SfcI CTRYAG 1 cut(s) 65
SgeI CNNG 9 cut(s) 23, 59, 88, 107, 151, 157, 166, 233, 254
SmiMI CAYNNNNRTG 1 cut(s) 99
Sse9I AATT 1 cut(s) 258
TaaI ACNGT 1 cut(s) 121
TasI AATT 1 cut(s) 258
TatI WGTACW 1 cut(s) 34
TscAI CASTG 1 cut(s) 126
TseI GCWGC 1 cut(s) 214
TspDTI ATGAA 3 cut(s) 17, 63, 111
TspRI CASTG 1 cut(s) 126
XmnI GAANNNNTTC 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.