Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr4B

Orthogroup ID

OG0020993

Physical Location & Seq

Genomic Coordinates Reverse (-)

38804064 .. 38812962

Gene Structure 8899 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh4BG225000.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 180 bp

ATGAATAAGGCTCAAAATGAGCGAGTGCCACAAAACCATGAAGAGAAGGGCTTTCTGCAGTTCCTCTTGGAAAATAATAATCATCAAGATAGTGCAACAATGCTTATACAACAAACGAAGGCCTTGCTCATGGACATTGTGGTGGGAGGAACCGACACCACAGCTATAACAGTAGAATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004497 GO:0005575 GO:0008150 GO:0008152 GO:0009058 GO:0016020 GO:0016491 GO:0016705 GO:0016709 GO:0019748 GO:0044550 GO:0055114

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

p450

Protein Analysis

59

Amino Acids

6.63

Weight (kDa)

4.88

Isoelectric Point (pI)

33.73

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
p450	PF00067	5 - 58	4.6e-06	Cytochrome P450

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020993)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G12334
rosa_chinensis	RchiOBHm_Chr4g0420041
rosa_multiflora	Rmu_co8043834.1_g000001
rosa_samantha	Rh4BG225000 Rh7DG199000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AluBI	AGCT	1 cut(s)	164
AluI	AGCT	1 cut(s)	164
AoxI	GGCC	1 cut(s)	120
BcgI	CGANNNNNNTGC	2 cut(s)	106, 140
BfmI	CTRYAG	1 cut(s)	56
BmiI	GGNNCC	1 cut(s)	151
BshFI	GGCC	1 cut(s)	122
BsnI	GGCC	1 cut(s)	122
BspANI	GGCC	1 cut(s)	122
BspLI	GGNNCC	1 cut(s)	151
BspMAI	CTGCAG	1 cut(s)	60
Bst4CI	ACNGT	1 cut(s)	172
Bst6I	CTCTTC	1 cut(s)	36
BstSFI	CTRYAG	1 cut(s)	56
BsuRI	GGCC	1 cut(s)	122
CviAII	CATG	2 cut(s)	38, 130
CviJI	RGCY	4 cut(s)	11, 51, 122, 164
CviKI_1	RGCY	4 cut(s)	11, 51, 122, 164
Eam1104I	CTCTTC	1 cut(s)	36
EarI	CTCTTC	1 cut(s)	36
Eco147I	AGGCCT	1 cut(s)	122
FaeI	CATG	2 cut(s)	41, 133
FaiI	YATR	4 cut(s)	39, 107, 131, 167
FatI	CATG	2 cut(s)	37, 129
HaeIII	GGCC	1 cut(s)	122
Hin1II	CATG	2 cut(s)	41, 133
Hpy188III	TCNNGA	1 cut(s)	86
HpyAV	CCTTC	2 cut(s)	40, 112
HpyCH4III	ACNGT	1 cut(s)	172
HpyCH4V	TGCA	2 cut(s)	58, 95
Hsp92II	CATG	2 cut(s)	41, 133
MboII	GAAGA	1 cut(s)	53
MnlI	CCTC	2 cut(s)	74, 140
MslI	CAYNNNNRTG	1 cut(s)	140
NlaIII	CATG	2 cut(s)	41, 133
NlaIV	GGNNCC	1 cut(s)	151
PceI	AGGCCT	1 cut(s)	122
PspN4I	GGNNCC	1 cut(s)	151
PstI	CTGCAG	1 cut(s)	60
RseI	CAYNNNNRTG	1 cut(s)	140
SetI	ASST	1 cut(s)	166
SfcI	CTRYAG	1 cut(s)	56
SgeI	CNNG	6 cut(s)	35, 50, 79, 98, 136, 142
SmiMI	CAYNNNNRTG	1 cut(s)	140
SseBI	AGGCCT	1 cut(s)	122
StuI	AGGCCT	1 cut(s)	122
TaaI	ACNGT	1 cut(s)	172
TspDTI	ATGAA	2 cut(s)	17, 54

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.