Rmu_co8059702.1_g000001

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8059702.1
OG0021059
Physical Location & Seq
Reverse (-)
1 .. 324
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8059702.1_g000001.1.cds

Sequence Viewer

Length: 301 bp
atgcttgtggtgggcgagtatgatggtctggttcctgtggaatcagtaccgctgaatctgatggaagcctgggtggttgtgaaaggattgtctattgcgctgaggaataaagtggctttatccatggtgggctcttctatagggcatgtcgtgcagttcaatctaaatgcgttgaagcgtaagggagaggagcagcgcatcaagattgttttcgatgtacgtcgtcgaattcgcacctcgatgatttttgaattctcatctattgtgaaactggagttggtgcttatctatcctgagttcg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00230 ko00670 ko01100 ko01110 ko01130 ko01523 map00230 map00670 map01100 map01110 map01130 map01523
Pfam Domains
Protein Families
DDE_Tnp_1_7 DUF4283 RVT_1 RVT_3 zf-CCHC_4 zf-RVT

Protein Analysis

100

Amino Acids

11.33

Weight (kDa)

9.52

Isoelectric Point (pI)

40.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021059)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g06577
rosa_multiflora Rmu_co8059702.1_g000001 Rmu_sc0002148.1_g000028
rosa_rugosa Rorug02G0525800 Rorug05G0340700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 50
AcsI RAATTY 2 cut(s) 228, 251
AfaI GTAC 2 cut(s) 48, 219
AgsI TTSAA 3 cut(s) 160, 175, 251
AjnI CCWGG 1 cut(s) 68
AjuI GAANNNNNNNTTGG 2 cut(s) 260, 292
ApeKI GCWGC 1 cut(s) 193
ApoI RAATTY 2 cut(s) 228, 251
AspLEI GCGC 2 cut(s) 100, 198
BanII GRGCYC 1 cut(s) 134
BbvCI CCTCAGC 1 cut(s) 101
BbvI GCAGC 1 cut(s) 205
BccI CCATC 2 cut(s) 17, 55
BciT130I CCWGG 1 cut(s) 70
BfmI CTRYAG 1 cut(s) 138
BisI GCNGC 1 cut(s) 194
BlsI GCNGC 1 cut(s) 195
Bme1390I CCNGG 1 cut(s) 70
BmiI GGNNCC 1 cut(s) 33
BmrFI CCNGG 1 cut(s) 70
BmsI GCATC 1 cut(s) 207
BpmI CTGGAG 1 cut(s) 293
Bpu10I CCTNAGC 1 cut(s) 101
BsaJI CCNNGG 2 cut(s) 69, 123
Bse1I ACTGG 1 cut(s) 276
BseBI CCWGG 1 cut(s) 70
BseDI CCNNGG 2 cut(s) 69, 123
BseMII CTCAG 2 cut(s) 92, 285
BseNI ACTGG 1 cut(s) 276
BseRI GAGGAG 1 cut(s) 203
BseXI GCAGC 1 cut(s) 205
BsgI GTGCAG 1 cut(s) 173
Bsp1286I GDGCHC 1 cut(s) 134
Bsp19I CCATGG 1 cut(s) 123
BspACI CCGC 1 cut(s) 50
BspCNI CTCAG 2 cut(s) 93, 286
BspLI GGNNCC 1 cut(s) 33
BspQI GCTCTTC 1 cut(s) 139
BsrI ACTGG 1 cut(s) 276
BssECI CCNNGG 2 cut(s) 69, 123
BssT1I CCWWGG 1 cut(s) 123
Bst2UI CCWGG 1 cut(s) 70
Bst6I CTCTTC 1 cut(s) 139
BstAPI GCANNNNNTGC 1 cut(s) 151
BstDEI CTNAG 2 cut(s) 101, 294
BstDSI CCRYGG 1 cut(s) 123
BstHHI GCGC 2 cut(s) 100, 198
BstMWI GCNNNNNNNGC 1 cut(s) 151
BstNI CCWGG 1 cut(s) 70
BstNSI RCATGY 1 cut(s) 149
BstSCI CCNGG 1 cut(s) 68
BstSFI CTRYAG 1 cut(s) 138
BstV1I GCAGC 1 cut(s) 205
BtgI CCRYGG 1 cut(s) 123
CfoI GCGC 2 cut(s) 100, 198
Csp6I GTAC 2 cut(s) 47, 218
CviAII CATG 2 cut(s) 124, 146
CviJI RGCY 3 cut(s) 68, 116, 132
CviKI_1 RGCY 3 cut(s) 68, 116, 132
CviQI GTAC 2 cut(s) 47, 218
DdeI CTNAG 2 cut(s) 101, 294
Eam1104I CTCTTC 1 cut(s) 139
EarI CTCTTC 1 cut(s) 139
Eco130I CCWWGG 1 cut(s) 123
Eco24I GRGCYC 1 cut(s) 134
EcoRI GAATTC 2 cut(s) 228, 251
EcoRII CCWGG 1 cut(s) 68
EcoT14I CCWWGG 1 cut(s) 123
EcoT38I GRGCYC 1 cut(s) 134
ErhI CCWWGG 1 cut(s) 123
FaeI CATG 2 cut(s) 127, 149
FaiI YATR 4 cut(s) 21, 125, 140, 147
FatI CATG 2 cut(s) 123, 145
Fnu4HI GCNGC 1 cut(s) 194
FriOI GRGCYC 1 cut(s) 134
Fsp4HI GCNGC 1 cut(s) 194
GlaI GCGC 2 cut(s) 99, 197
GluI GCNGC 1 cut(s) 194
GsuI CTGGAG 1 cut(s) 293
HhaI GCGC 2 cut(s) 100, 198
Hin1II CATG 2 cut(s) 127, 149
Hin6I GCGC 2 cut(s) 98, 196
HinP1I GCGC 2 cut(s) 98, 196
HinfI GANTC 2 cut(s) 41, 55
Hpy188I TCNGA 1 cut(s) 60
Hpy188III TCNNGA 2 cut(s) 202, 293
Hpy99I CGWCG 2 cut(s) 225, 228
HpyCH4IV ACGT 1 cut(s) 220
HpyCH4V TGCA 1 cut(s) 154
HpyF10VI GCNNNNNNNGC 1 cut(s) 151
HpyF3I CTNAG 2 cut(s) 101, 294
HpySE526I ACGT 1 cut(s) 220
Hsp92II CATG 2 cut(s) 127, 149
HspAI GCGC 2 cut(s) 98, 196
LguI GCTCTTC 1 cut(s) 139
LmnI GCTCC 1 cut(s) 190
LpnPI CCDG 5 cut(s) 14, 48, 55, 82, 257
Lsp1109I GCAGC 1 cut(s) 205
LweI GCATC 1 cut(s) 207
MaeII ACGT 1 cut(s) 220
MboII GAAGA 1 cut(s) 126
MhlI GDGCHC 1 cut(s) 134
MluCI AATT 2 cut(s) 228, 251
MnlI CCTC 3 cut(s) 96, 181, 247
MslI CAYNNNNRTG 1 cut(s) 239
MspA1I CMGCKG 1 cut(s) 52
MspR9I CCNGG 1 cut(s) 70
MvaI CCWGG 1 cut(s) 70
MwoI GCNNNNNNNGC 1 cut(s) 151
NcoI CCATGG 1 cut(s) 123
NlaIII CATG 2 cut(s) 127, 149
NlaIV GGNNCC 1 cut(s) 33
NspI RCATGY 1 cut(s) 149
PciSI GCTCTTC 1 cut(s) 139
PfeI GAWTC 2 cut(s) 41, 55
PkrI GCNGC 1 cut(s) 195
Psp6I CCWGG 1 cut(s) 68
PspGI CCWGG 1 cut(s) 68
PspN4I GGNNCC 1 cut(s) 33
RsaI GTAC 2 cut(s) 48, 219
RsaNI GTAC 2 cut(s) 47, 218
RseI CAYNNNNRTG 1 cut(s) 239
SapI GCTCTTC 1 cut(s) 139
SatI GCNGC 1 cut(s) 194
ScrFI CCNGG 1 cut(s) 70
SduI GDGCHC 1 cut(s) 134
SetI ASST 2 cut(s) 223, 239
SfaNI GCATC 1 cut(s) 207
SfcI CTRYAG 1 cut(s) 138
SmiMI CAYNNNNRTG 1 cut(s) 239
Sse9I AATT 2 cut(s) 228, 251
SsiI CCGC 1 cut(s) 50
StyD4I CCNGG 1 cut(s) 68
StyI CCWWGG 1 cut(s) 123
TaiI ACGT 1 cut(s) 223
TaqI TCGA 3 cut(s) 213, 226, 239
TasI AATT 2 cut(s) 228, 251
TfiI GAWTC 2 cut(s) 41, 55
TseI GCWGC 1 cut(s) 193
XapI RAATTY 2 cut(s) 228, 251
XceI RCATGY 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.