Rmu_co8118650.1_g000001

Splicing factor U2af large subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8118650.1
Physical Location & Seq
Forward (+)
1 .. 427
427 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8118650.1_g000001.1.cds

Sequence Viewer

Length: 212 bp
gttcacttgtgagcgtcatcattccacgtccacgaccagatggtcaaccctcacctggagttggaaaggtgtttttggagtatgcggatgtcgatggttccacaaaagcccgtacagggatgaatggcaggaaatttggtgggaatccagttgtggcagtgttttatccggaggacaagtttgcccagggtgactatgacgctagttgctag

Protein Analysis

69

Amino Acids

7.33

Weight (kDa)

6.04

Isoelectric Point (pI)

38.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020969)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G60830 AT1G60830
pyrus_communis pycom10g24930
rosa_multiflora Rmu_co8118650.1_g000001 Rmu_sc0039049.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 41
AccIII TCCGGA 1 cut(s) 168
AciI CCGC 1 cut(s) 85
AcsI RAATTY 1 cut(s) 133
AfaI GTAC 1 cut(s) 114
AfiI CCNNNNNNNGG 3 cut(s) 55, 61, 116
AjiI CACGTC 1 cut(s) 28
AjnI CCWGG 2 cut(s) 54, 185
Aor13HI TCCGGA 1 cut(s) 168
ApoI RAATTY 1 cut(s) 133
AsuHPI GGTGA 2 cut(s) 44, 202
BccI CCATC 2 cut(s) 34, 88
BciT130I CCWGG 2 cut(s) 56, 187
BfaI CTAG 2 cut(s) 203, 210
Bme1390I CCNGG 2 cut(s) 56, 187
BmgBI CACGTC 1 cut(s) 28
BmiI GGNNCC 1 cut(s) 99
BmrFI CCNGG 2 cut(s) 56, 187
BpmI CTGGAG 1 cut(s) 77
BsaJI CCNNGG 2 cut(s) 185, 186
BsaWI WCCGGW 1 cut(s) 168
BsaXI ACNNNNNCTCC 2 cut(s) 163, 193
Bsc4I CCNNNNNNNGG 3 cut(s) 55, 61, 116
Bse1I ACTGG 1 cut(s) 148
BseAI TCCGGA 1 cut(s) 168
BseBI CCWGG 2 cut(s) 56, 187
BseDI CCNNGG 2 cut(s) 185, 186
BseGI GGATG 2 cut(s) 93, 125
BseLI CCNNNNNNNGG 3 cut(s) 55, 61, 116
BseNI ACTGG 1 cut(s) 148
BsiSI CCGG 1 cut(s) 169
BslI CCNNNNNNNGG 3 cut(s) 55, 61, 116
Bsp13I TCCGGA 1 cut(s) 168
BspACI CCGC 1 cut(s) 85
BspEI TCCGGA 1 cut(s) 168
BspLI GGNNCC 1 cut(s) 99
BsrI ACTGG 1 cut(s) 148
BssECI CCNNGG 2 cut(s) 185, 186
Bst2UI CCWGG 2 cut(s) 56, 187
BstF5I GGATG 2 cut(s) 93, 125
BstNI CCWGG 2 cut(s) 56, 187
BstSCI CCNGG 2 cut(s) 54, 185
BtrI CACGTC 1 cut(s) 28
BtsCI GGATG 2 cut(s) 93, 125
BtsI GCAGTG 1 cut(s) 164
BtsIMutI CAGTG 1 cut(s) 164
CseI GACGC 1 cut(s) 3
Csp6I GTAC 1 cut(s) 113
CviJI RGCY 1 cut(s) 109
CviKI_1 RGCY 1 cut(s) 109
CviQI GTAC 1 cut(s) 113
DrdI GACNNNNNNGTC 1 cut(s) 41
DseDI GACNNNNNNGTC 1 cut(s) 41
EcoRII CCWGG 2 cut(s) 54, 185
FaiI YATR 2 cut(s) 83, 197
FokI GGATG 2 cut(s) 100, 132
FspBI CTAG 2 cut(s) 203, 210
GsuI CTGGAG 1 cut(s) 77
HapII CCGG 1 cut(s) 169
HgaI GACGC 1 cut(s) 3
HincII GTYRAC 1 cut(s) 46
HindII GTYRAC 1 cut(s) 46
HinfI GANTC 1 cut(s) 144
HpaII CCGG 1 cut(s) 169
HphI GGTGA 2 cut(s) 44, 202
Hpy166II GTNNAC 3 cut(s) 4, 31, 46
Hpy188III TCNNGA 1 cut(s) 169
Hpy8I GTNNAC 3 cut(s) 4, 31, 46
HpyCH4IV ACGT 1 cut(s) 27
HpySE526I ACGT 1 cut(s) 27
Kpn2I TCCGGA 1 cut(s) 168
LpnPI CCDG 9 cut(s) 41, 50, 68, 101, 114, 161, 172, 182, 199
MaeI CTAG 2 cut(s) 203, 210
MaeII ACGT 1 cut(s) 27
MaeIII GTNAC 1 cut(s) 190
MluCI AATT 1 cut(s) 133
MmeI TCCRAC 1 cut(s) 42
MnlI CCTC 2 cut(s) 60, 165
MroI TCCGGA 1 cut(s) 168
MspI CCGG 1 cut(s) 169
MspR9I CCNGG 2 cut(s) 56, 187
MvaI CCWGG 2 cut(s) 56, 187
NlaIV GGNNCC 1 cut(s) 99
NmuCI GTSAC 1 cut(s) 190
PasI CCCWGGG 1 cut(s) 186
PfeI GAWTC 1 cut(s) 144
Psp6I CCWGG 2 cut(s) 54, 185
PspGI CCWGG 2 cut(s) 54, 185
PspN4I GGNNCC 1 cut(s) 99
RsaI GTAC 1 cut(s) 114
RsaNI GTAC 1 cut(s) 113
ScrFI CCNGG 2 cut(s) 56, 187
SetI ASST 3 cut(s) 30, 57, 71
Sse9I AATT 1 cut(s) 133
SsiI CCGC 1 cut(s) 85
SspMI CTAG 2 cut(s) 203, 210
StyD4I CCNGG 2 cut(s) 54, 185
TaiI ACGT 1 cut(s) 30
TaqI TCGA 1 cut(s) 92
TasI AATT 1 cut(s) 133
TfiI GAWTC 1 cut(s) 144
TscAI CASTG 1 cut(s) 164
TseFI GTSAC 1 cut(s) 190
Tsp45I GTSAC 1 cut(s) 190
TspDTI ATGAA 1 cut(s) 136
TspRI CASTG 1 cut(s) 164
XapI RAATTY 1 cut(s) 133
XspI CTAG 2 cut(s) 203, 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.