Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0039049.1

Orthogroup ID

OG0020969

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 410

Gene Structure 410 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0039049.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 180 bp

aggttcctgttgttgcaacagcctgcttcggtggccaccaaagttgtatgcttaacacaagtagttacagaggatgagctgaaggatgatcttgagtatgaagacatagtggaagatatgaagcaagagggcgagaaatttggtaaatcttcagtcattgttacctgcattttactttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000243 GO:0000375 GO:0000377 GO:0000398 GO:0003674 GO:0003676 GO:0003723 GO:0003727 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005681 GO:0005684 GO:0006139 GO:0006396 GO:0006397 GO:0006725 GO:0006807 GO:0006950 GO:0006952 GO:0008150 GO:0008152 GO:0008187 GO:0008380 GO:0009605 GO:0009607 GO:0009617 GO:0009987 GO:0010467 GO:0016070 GO:0016071 GO:0016604 GO:0016607 GO:0030628 GO:0031974 GO:0031981 GO:0032991 GO:0034641 GO:0036002 GO:0042742 GO:0043170 GO:0043207 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0044237 GO:0044238 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044451 GO:0044464 GO:0046483 GO:0050896 GO:0051704 GO:0051707 GO:0070013 GO:0071004 GO:0071010 GO:0071704 GO:0089701 GO:0090304 GO:0097159 GO:0098542 GO:1901360 GO:1901363 GO:1990904

KEGG Pathways

Metabolic & Signaling

ko03040 map03040

Pfam Domains

Protein Families

RRM_1

Protein Analysis

59

Amino Acids

6.66

Weight (kDa)

4.31

Isoelectric Point (pI)

40.09

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020969)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G60830 AT1G60830
pyrus_communis	pycom10g24930
rosa_multiflora	Rmu_co8118650.1_g000001 Rmu_sc0039049.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	173
AcoI	YGGCCR	1 cut(s)	33
AcsI	RAATTY	1 cut(s)	137
AcuI	CTGAAG	2 cut(s)	101, 135
AluBI	AGCT	1 cut(s)	79
AluI	AGCT	1 cut(s)	79
AoxI	GGCC	1 cut(s)	33
ApoI	RAATTY	1 cut(s)	137
BalI	TGGCCA	1 cut(s)	35
BbsI	GAAGAC	1 cut(s)	108
BfuAI	ACCTGC	1 cut(s)	173
BmiI	GGNNCC	1 cut(s)	5
BpiI	GAAGAC	1 cut(s)	108
BpuEI	CTTGAG	1 cut(s)	113
BseGI	GGATG	2 cut(s)	79, 91
BshFI	GGCC	1 cut(s)	35
BsnI	GGCC	1 cut(s)	35
Bsp143I	GATC	1 cut(s)	88
BspANI	GGCC	1 cut(s)	35
BspLI	GGNNCC	1 cut(s)	5
BspMI	ACCTGC	1 cut(s)	173
BssMI	GATC	1 cut(s)	88
BstC8I	GCNNGC	1 cut(s)	24
BstF5I	GGATG	2 cut(s)	79, 91
BstKTI	GATC	1 cut(s)	91
BstMBI	GATC	1 cut(s)	88
BstMWI	GCNNNNNNNGC	1 cut(s)	32
BstV2I	GAAGAC	1 cut(s)	108
BsuRI	GGCC	1 cut(s)	35
BtsCI	GGATG	2 cut(s)	79, 91
BveI	ACCTGC	1 cut(s)	173
Cac8I	GCNNGC	1 cut(s)	24
CspCI	CAANNNNNGTGG	2 cut(s)	25, 60
CviJI	RGCY	3 cut(s)	22, 35, 79
CviKI_1	RGCY	3 cut(s)	22, 35, 79
DpnI	GATC	1 cut(s)	90
DpnII	GATC	1 cut(s)	88
EaeI	YGGCCR	1 cut(s)	33
Eco57I	CTGAAG	2 cut(s)	101, 135
FaiI	YATR	4 cut(s)	49, 99, 107, 119
FokI	GGATG	2 cut(s)	86, 98
HaeIII	GGCC	1 cut(s)	35
Hpy188III	TCNNGA	1 cut(s)	92
HpyAV	CCTTC	1 cut(s)	76
HpyCH4V	TGCA	2 cut(s)	16, 168
HpyF10VI	GCNNNNNNNGC	1 cut(s)	32
Kzo9I	GATC	1 cut(s)	88
LpnPI	CCDG	2 cut(s)	20, 36
MaeIII	GTNAC	2 cut(s)	64, 160
MalI	GATC	1 cut(s)	90
MboI	GATC	1 cut(s)	88
MboII	GAAGA	3 cut(s)	113, 125, 141
MlsI	TGGCCA	1 cut(s)	35
MluCI	AATT	1 cut(s)	137
MluNI	TGGCCA	1 cut(s)	35
MnlI	CCTC	2 cut(s)	64, 121
Mox20I	TGGCCA	1 cut(s)	35
MscI	TGGCCA	1 cut(s)	35
MseI	TTAA	1 cut(s)	53
Msp20I	TGGCCA	1 cut(s)	35
MwoI	GCNNNNNNNGC	1 cut(s)	32
NdeII	GATC	1 cut(s)	88
NlaIV	GGNNCC	1 cut(s)	5
PspN4I	GGNNCC	1 cut(s)	5
SaqAI	TTAA	1 cut(s)	53
Sau3AI	GATC	1 cut(s)	88
SetI	ASST	2 cut(s)	81, 167
SgeI	CNNG	6 cut(s)	19, 35, 71, 104, 137, 145
SmlI	CTYRAG	1 cut(s)	92
SmoI	CTYRAG	1 cut(s)	92
Sse9I	AATT	1 cut(s)	137
TasI	AATT	1 cut(s)	137
Tru1I	TTAA	1 cut(s)	53
Tru9I	TTAA	1 cut(s)	53
TspDTI	ATGAA	2 cut(s)	114, 134
XapI	RAATTY	1 cut(s)	137

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.