Rmu_co8264059.1_g000001

ABC transporter C family member

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8264059.1
Physical Location & Seq
Reverse (-)
1 .. 381
381 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8264059.1_g000001.1.cds

Sequence Viewer

Length: 171 bp
atgattggtgtggaaaccaagatctatatctgtgagtttcgatggtttgtaagatttggagtaatttatactatagtaggggatgctgtggtgttcaatctcattcttacagtgaaggacttctacagcagatctgtattttatttgtacatcagtgaagttgttgctcag

Protein Analysis

57

Amino Acids

6.72

Weight (kDa)

6.04

Isoelectric Point (pI)

41.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020543)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0015431 RchiOBHm_Chr5g0015471 RchiOBHm_Chr5g0067651
rosa_multiflora Rmu_co8264059.1_g000001
rosa_rugosa Rorug05G0027600
rosa_wichuraiana Rw5G045960

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 149
AgsI TTSAA 1 cut(s) 97
Asp700I GAANNNNTTC 1 cut(s) 119
BarI GAAGNNNNNNTAC 2 cut(s) 107, 139
BccI CCATC 1 cut(s) 36
BfmI CTRYAG 2 cut(s) 72, 124
BglII AGATCT 2 cut(s) 21, 131
BmsI GCATC 1 cut(s) 73
BsaBI GATNNNNATC 1 cut(s) 26
Bse8I GATNNNNATC 1 cut(s) 26
BseGI GGATG 1 cut(s) 88
BseJI GATNNNNATC 1 cut(s) 26
Bsp1407I TGTACA 1 cut(s) 147
Bsp143I GATC 2 cut(s) 21, 131
BsrGI TGTACA 1 cut(s) 147
BssMI GATC 2 cut(s) 21, 131
Bst4CI ACNGT 1 cut(s) 112
BstAUI TGTACA 1 cut(s) 147
BstDEI CTNAG 1 cut(s) 168
BstF5I GGATG 1 cut(s) 88
BstKTI GATC 2 cut(s) 24, 134
BstMBI GATC 2 cut(s) 21, 131
BstSFI CTRYAG 2 cut(s) 72, 124
BstX2I RGATCY 2 cut(s) 21, 131
BstYI RGATCY 2 cut(s) 21, 131
BtsCI GGATG 1 cut(s) 88
BtsIMutI CAGTG 2 cut(s) 117, 160
Csp6I GTAC 1 cut(s) 148
CviQI GTAC 1 cut(s) 148
DdeI CTNAG 1 cut(s) 168
DpnI GATC 2 cut(s) 23, 133
DpnII GATC 2 cut(s) 21, 131
FaiI YATR 3 cut(s) 27, 69, 74
FokI GGATG 1 cut(s) 95
FspEI CC 8 cut(s) 28, 31, 42, 63, 64, 65, 74, 101
HpyAV CCTTC 1 cut(s) 109
HpyCH4III ACNGT 1 cut(s) 112
HpyF3I CTNAG 1 cut(s) 168
Kzo9I GATC 2 cut(s) 21, 131
LweI GCATC 1 cut(s) 73
MalI GATC 2 cut(s) 23, 133
MboI GATC 2 cut(s) 21, 131
MflI RGATCY 2 cut(s) 21, 131
MluCI AATT 1 cut(s) 63
MroXI GAANNNNTTC 1 cut(s) 119
NdeII GATC 2 cut(s) 21, 131
PdmI GAANNNNTTC 1 cut(s) 119
PsuI RGATCY 2 cut(s) 21, 131
RsaI GTAC 1 cut(s) 149
RsaNI GTAC 1 cut(s) 148
Sau3AI GATC 2 cut(s) 21, 131
SfaNI GCATC 1 cut(s) 73
SfcI CTRYAG 2 cut(s) 72, 124
SgeI CNNG 1 cut(s) 31
Sse9I AATT 1 cut(s) 63
TaaI ACNGT 1 cut(s) 112
TaqI TCGA 1 cut(s) 40
TasI AATT 1 cut(s) 63
TatI WGTACW 1 cut(s) 147
TscAI CASTG 2 cut(s) 117, 160
TspRI CASTG 2 cut(s) 117, 160
XmnI GAANNNNTTC 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.