Rmu_co8313601.1_g000001

Belongs to the thiolase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8313601.1
Physical Location & Seq
Reverse (-)
1 .. 927
927 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8313601.1_g000001.1.cds

Sequence Viewer

Length: 275 bp
tgttgccgaccaaaaaggaattccaattcttggtgtattcaggagtttcgttgctgttggtgtggatcctgccatcatgggtgttggcccagctgctgcaattccagttgcagtcaaggcagctggtttagagcttgatgatattgacctttttgagataaatgaggcttttgcttcccaatttgtgtattgccgtaacaagctaggacttgatccagaaaaaatcaatgttaatggaggtgcattggccattggccatccacttggtgcaacag
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

9.32

Weight (kDa)

4.6

Isoelectric Point (pI)

20.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021027)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g19480
pyrus_communis pycom05g16530 pycom10g14520
rosa_multiflora Rmu_co8313601.1_g000001
rosa_roxburghii Rroxscaffold_7G00183500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 30
AclWI GGATC 3 cut(s) 60, 73, 207
AcoI YGGCCR 2 cut(s) 247, 254
AcsI RAATTY 1 cut(s) 19
AdeI CACNNNGTG 1 cut(s) 267
AfiI CCNNNNNNNGG 1 cut(s) 30
AjuI GAANNNNNNNTTGG 1 cut(s) 36
AluBI AGCT 4 cut(s) 93, 123, 134, 203
AluI AGCT 4 cut(s) 93, 123, 134, 203
AlwI GGATC 3 cut(s) 60, 73, 207
AlwNI CAGNNNCTG 1 cut(s) 96
AoxI GGCC 3 cut(s) 86, 247, 254
ApeKI GCWGC 3 cut(s) 93, 96, 120
ApoI RAATTY 1 cut(s) 19
AspS9I GGNCC 1 cut(s) 87
BalI TGGCCA 2 cut(s) 249, 256
BamHI GGATCC 1 cut(s) 65
BbvI GCAGC 3 cut(s) 80, 83, 132
BccI CCATC 2 cut(s) 81, 265
BceAI ACGGC 1 cut(s) 178
BfaI CTAG 1 cut(s) 204
BisI GCNGC 3 cut(s) 94, 97, 121
BlsI GCNGC 3 cut(s) 95, 98, 122
BmgT120I GGNCC 1 cut(s) 87
BmiI GGNNCC 1 cut(s) 67
Bsc4I CCNNNNNNNGG 1 cut(s) 30
Bse1I ACTGG 1 cut(s) 105
BseGI GGATG 1 cut(s) 257
BseLI CCNNNNNNNGG 1 cut(s) 30
BseNI ACTGG 1 cut(s) 105
BseXI GCAGC 3 cut(s) 80, 83, 132
BseYI CCCAGC 1 cut(s) 89
BshFI GGCC 3 cut(s) 88, 249, 256
BslI CCNNNNNNNGG 1 cut(s) 30
BsnI GGCC 3 cut(s) 88, 249, 256
Bsp143I GATC 2 cut(s) 65, 212
BspANI GGCC 3 cut(s) 88, 249, 256
BspLI GGNNCC 1 cut(s) 67
BspPI GGATC 3 cut(s) 60, 73, 207
BsrI ACTGG 1 cut(s) 105
BssMI GATC 2 cut(s) 65, 212
BstF5I GGATG 1 cut(s) 257
BstKTI GATC 2 cut(s) 68, 215
BstMBI GATC 2 cut(s) 65, 212
BstMWI GCNNNNNNNGC 1 cut(s) 117
BstV1I GCAGC 3 cut(s) 80, 83, 132
BstX2I RGATCY 1 cut(s) 65
BstXI CCANNNNNNTGG 1 cut(s) 264
BstYI RGATCY 1 cut(s) 65
BsuRI GGCC 3 cut(s) 88, 249, 256
BtsCI GGATG 1 cut(s) 257
CaiI CAGNNNCTG 1 cut(s) 96
Cfr13I GGNCC 1 cut(s) 87
CviAII CATG 1 cut(s) 77
CviJI RGCY 8 cut(s) 88, 93, 123, 134, 168, 203, 249, 256
CviKI_1 RGCY 8 cut(s) 88, 93, 123, 134, 168, 203, 249, 256
DpnI GATC 2 cut(s) 67, 214
DpnII GATC 2 cut(s) 65, 212
DraIII CACNNNGTG 1 cut(s) 267
EaeI YGGCCR 2 cut(s) 247, 254
EcoRI GAATTC 1 cut(s) 19
FaeI CATG 1 cut(s) 80
FaiI YATR 1 cut(s) 78
FatI CATG 1 cut(s) 76
Fnu4HI GCNGC 3 cut(s) 94, 97, 121
FokI GGATG 1 cut(s) 244
Fsp4HI GCNGC 3 cut(s) 94, 97, 121
FspBI CTAG 1 cut(s) 204
GluI GCNGC 3 cut(s) 94, 97, 121
GsaI CCCAGC 1 cut(s) 93
HaeIII GGCC 3 cut(s) 88, 249, 256
Hin1II CATG 1 cut(s) 80
Hpy188III TCNNGA 2 cut(s) 41, 216
HpyCH4V TGCA 4 cut(s) 99, 111, 243, 270
HpyF10VI GCNNNNNNNGC 1 cut(s) 117
Hsp92II CATG 1 cut(s) 80
Kzo9I GATC 2 cut(s) 65, 212
LpnPI CCDG 6 cut(s) 26, 82, 103, 109, 118, 229
Lsp1109I GCAGC 3 cut(s) 80, 83, 132
MaeI CTAG 1 cut(s) 204
MaeIII GTNAC 1 cut(s) 195
MalI GATC 2 cut(s) 67, 214
MboI GATC 2 cut(s) 65, 212
MflI RGATCY 1 cut(s) 65
MlsI TGGCCA 2 cut(s) 249, 256
MluCI AATT 4 cut(s) 19, 25, 100, 180
MluNI TGGCCA 2 cut(s) 249, 256
MnlI CCTC 2 cut(s) 158, 231
Mox20I TGGCCA 2 cut(s) 249, 256
MscI TGGCCA 2 cut(s) 249, 256
MseI TTAA 1 cut(s) 232
Msp20I TGGCCA 2 cut(s) 249, 256
MspA1I CMGCKG 2 cut(s) 93, 123
MwoI GCNNNNNNNGC 1 cut(s) 117
NdeII GATC 2 cut(s) 65, 212
NlaIII CATG 1 cut(s) 80
NlaIV GGNNCC 1 cut(s) 67
PflMI CCANNNNNTGG 1 cut(s) 30
PkrI GCNGC 3 cut(s) 95, 98, 122
PspFI CCCAGC 1 cut(s) 89
PspN4I GGNNCC 1 cut(s) 67
PspPI GGNCC 1 cut(s) 87
PstNI CAGNNNCTG 1 cut(s) 96
PsuI RGATCY 1 cut(s) 65
PvuII CAGCTG 2 cut(s) 93, 123
SaqAI TTAA 1 cut(s) 232
SatI GCNGC 3 cut(s) 94, 97, 121
Sau3AI GATC 2 cut(s) 65, 212
Sau96I GGNCC 1 cut(s) 87
SetI ASST 6 cut(s) 95, 125, 136, 151, 205, 242
Sse9I AATT 4 cut(s) 19, 25, 100, 180
SspMI CTAG 1 cut(s) 204
TasI AATT 4 cut(s) 19, 25, 100, 180
Tru1I TTAA 1 cut(s) 232
Tru9I TTAA 1 cut(s) 232
TseI GCWGC 3 cut(s) 93, 96, 120
Van91I CCANNNNNTGG 1 cut(s) 30
XapI RAATTY 1 cut(s) 19
XspI CTAG 1 cut(s) 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.