Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8334785.1

Orthogroup ID

OG0020474

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 638

Gene Structure 638 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8334785.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 504 bp

atgaagggattgaagcagaagaaagcacatcttatggagatccaggtgaatggtggcacaattgctcagaaggttgaatttgctaaaagcttctttgagaagcaaatccctattgatgctgtcttccagaaagatgagatgatcgatatcattggtgtaacaaagggtaaaggttatgaaggtgttgttactcgttggggtgtaacccgtcttcctcgtaagactcataggggtctgcgtaaggttgcttgtattggtgcctggcatcctgctagagtctcatttacagttgctagggctggtcagaatggataccatcatcgtactgaaatgaacaagaaaatttacaagcttggaaaggctggacaagagtctcacactgctgtcactgagtttgataggactgagaaagacatcactccgattggtggcttccctcattatggtgtggtgaaagatgactacattctgatcaagggatgctgtgttggacccaagaagagg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000027 GO:0003674 GO:0003676 GO:0003723 GO:0003735 GO:0005198 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0005840 GO:0006412 GO:0006518 GO:0006807 GO:0006996 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009987 GO:0010467 GO:0015934 GO:0016043 GO:0019538 GO:0022607 GO:0022613 GO:0022618 GO:0022625 GO:0022626 GO:0032991 GO:0034622 GO:0034641 GO:0034645 GO:0042254 GO:0042255 GO:0042273 GO:0043043 GO:0043170 GO:0043226 GO:0043228 GO:0043229 GO:0043232 GO:0043603 GO:0043604 GO:0043933 GO:0044085 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044267 GO:0044271 GO:0044391 GO:0044422 GO:0044424 GO:0044444 GO:0044445 GO:0044446 GO:0044464 GO:0065003 GO:0070925 GO:0071704 GO:0071826 GO:0071840 GO:0097159 GO:1901363 GO:1901564 GO:1901566 GO:1901576 GO:1990904

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_L3

Protein Analysis

168

Amino Acids

18.85

Weight (kDa)

9.88

Isoelectric Point (pI)

23.96

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020474)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0361591 RchiOBHm_Chr1g0361651
rosa_multiflora	Rmu_co8334785.1_g000001 Rmu_sc0003426.1_g000008 Rmu_sc0010981.1_g000001 Rmu_sc0024847.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	257
AclWI	GGATC	1 cut(s)	34
AcsI	RAATTY	2 cut(s)	77, 342
AfaI	GTAC	1 cut(s)	325
AfiI	CCNNNNNNNGG	3 cut(s)	428, 443, 501
AgsI	TTSAA	2 cut(s)	13, 77
AjnI	CCWGG	2 cut(s)	42, 260
AluBI	AGCT	2 cut(s)	90, 352
AluI	AGCT	2 cut(s)	90, 352
Alw26I	GTCTC	2 cut(s)	283, 378
AlwI	GGATC	1 cut(s)	34
ApoI	RAATTY	2 cut(s)	77, 342
AspS9I	GGNCC	1 cut(s)	491
AsuHPI	GGTGA	2 cut(s)	58, 463
AvaII	GGWCC	1 cut(s)	491
BanI	GGYRCC	1 cut(s)	257
BarI	GAAGNNNNNNTAC	2 cut(s)	195, 227
BbsI	GAAGAC	2 cut(s)	115, 203
BccI	CCATC	1 cut(s)	324
BciT130I	CCWGG	2 cut(s)	44, 262
BciVI	GTATCC	1 cut(s)	305
BclI	TGATCA	1 cut(s)	471
BcoDI	GTCTC	2 cut(s)	283, 378
BfaI	CTAG	2 cut(s)	273, 294
BfuI	GTATCC	1 cut(s)	305
Bme1390I	CCNGG	2 cut(s)	44, 262
Bme18I	GGWCC	1 cut(s)	491
BmgT120I	GGNCC	1 cut(s)	491
BmiI	GGNNCC	2 cut(s)	259, 493
BmrFI	CCNGG	2 cut(s)	44, 262
BmsI	GCATC	3 cut(s)	106, 274, 470
BoxI	GACNNNNGTC	1 cut(s)	370
BpiI	GAAGAC	2 cut(s)	115, 203
Bsa29I	ATCGAT	1 cut(s)	144
BsaBI	GATNNNNATC	1 cut(s)	146
Bsc4I	CCNNNNNNNGG	3 cut(s)	428, 443, 501
Bse8I	GATNNNNATC	1 cut(s)	146
BseBI	CCWGG	2 cut(s)	44, 262
BseCI	ATCGAT	1 cut(s)	144
BseGI	GGATG	2 cut(s)	265, 485
BseJI	GATNNNNATC	1 cut(s)	146
BseLI	CCNNNNNNNGG	3 cut(s)	428, 443, 501
BseMII	CTCAG	3 cut(s)	80, 381, 396
BshNI	GGYRCC	1 cut(s)	257
BshVI	ATCGAT	1 cut(s)	144
BslI	CCNNNNNNNGG	3 cut(s)	428, 443, 501
BsmAI	GTCTC	2 cut(s)	283, 378
Bsp143I	GATC	3 cut(s)	39, 141, 471
BspCNI	CTCAG	3 cut(s)	79, 382, 397
BspDI	ATCGAT	1 cut(s)	144
BspLI	GGNNCC	2 cut(s)	259, 493
BspPI	GGATC	1 cut(s)	34
BspT107I	GGYRCC	1 cut(s)	257
BssMI	GATC	3 cut(s)	39, 141, 471
Bst2UI	CCWGG	2 cut(s)	44, 262
Bst4CI	ACNGT	1 cut(s)	289
Bst6I	CTCTTC	1 cut(s)	494
BstDEI	CTNAG	3 cut(s)	66, 390, 405
BstF5I	GGATG	2 cut(s)	265, 485
BstKTI	GATC	3 cut(s)	42, 144, 474
BstMAI	GTCTC	2 cut(s)	283, 378
BstMBI	GATC	3 cut(s)	39, 141, 471
BstNI	CCWGG	2 cut(s)	44, 262
BstPAI	GACNNNNGTC	1 cut(s)	370
BstSCI	CCNGG	2 cut(s)	42, 260
BstV2I	GAAGAC	2 cut(s)	115, 203
BstX2I	RGATCY	1 cut(s)	39
BstXI	CCANNNNNNTGG	1 cut(s)	50
BstYI	RGATCY	1 cut(s)	39
Bsu15I	ATCGAT	1 cut(s)	144
BsuI	GTATCC	1 cut(s)	305
BsuTUI	ATCGAT	1 cut(s)	144
BtsCI	GGATG	2 cut(s)	265, 485
BtsI	GCAGTG	1 cut(s)	378
BtsIMutI	CAGTG	2 cut(s)	378, 387
Cfr13I	GGNCC	1 cut(s)	491
ClaI	ATCGAT	1 cut(s)	144
Csp6I	GTAC	1 cut(s)	324
CviJI	RGCY	5 cut(s)	90, 299, 352, 362, 432
CviKI_1	RGCY	5 cut(s)	90, 299, 352, 362, 432
CviQI	GTAC	1 cut(s)	324
DdeI	CTNAG	3 cut(s)	66, 390, 405
DpnI	GATC	3 cut(s)	41, 143, 473
DpnII	GATC	3 cut(s)	39, 141, 471
Eam1104I	CTCTTC	1 cut(s)	494
EarI	CTCTTC	1 cut(s)	494
Eco32I	GATATC	1 cut(s)	148
Eco47I	GGWCC	1 cut(s)	491
EcoRII	CCWGG	2 cut(s)	42, 260
EcoRV	GATATC	1 cut(s)	148
FaiI	YATR	4 cut(s)	35, 177, 228, 444
FalI	AAGNNNNNCTT	2 cut(s)	15, 47
FbaI	TGATCA	1 cut(s)	471
FokI	GGATG	2 cut(s)	252, 492
FspBI	CTAG	2 cut(s)	273, 294
HindIII	AAGCTT	2 cut(s)	88, 350
HinfI	GANTC	3 cut(s)	223, 276, 371
HphI	GGTGA	2 cut(s)	58, 463
Hpy188I	TCNGA	4 cut(s)	69, 306, 423, 471
Hpy188III	TCNNGA	1 cut(s)	127
HpyAV	CCTTC	2 cut(s)	64, 173
HpyCH4III	ACNGT	1 cut(s)	289
HpyF3I	CTNAG	3 cut(s)	66, 390, 405
Ksp22I	TGATCA	1 cut(s)	471
Kzo9I	GATC	3 cut(s)	39, 141, 471
LpnPI	CCDG	8 cut(s)	29, 56, 140, 247, 274, 282, 285, 348
LweI	GCATC	3 cut(s)	106, 274, 470
MaeI	CTAG	2 cut(s)	273, 294
MaeIII	GTNAC	4 cut(s)	157, 187, 202, 385
MalI	GATC	3 cut(s)	41, 143, 473
MboI	GATC	3 cut(s)	39, 141, 471
MboII	GAAGA	3 cut(s)	31, 115, 203
MfeI	CAATTG	1 cut(s)	60
MflI	RGATCY	1 cut(s)	39
MluCI	AATT	3 cut(s)	60, 77, 342
MlyI	GAGTC	3 cut(s)	217, 285, 380
MmeI	TCCRAC	1 cut(s)	469
MnlI	CCTC	3 cut(s)	225, 447, 495
MslI	CAYNNNNRTG	1 cut(s)	444
MspR9I	CCNGG	2 cut(s)	44, 262
MunI	CAATTG	1 cut(s)	60
MvaI	CCWGG	2 cut(s)	44, 262
NdeII	GATC	3 cut(s)	39, 141, 471
NlaIV	GGNNCC	2 cut(s)	259, 493
NmuCI	GTSAC	1 cut(s)	385
PleI	GAGTC	3 cut(s)	217, 284, 379
PpsI	GAGTC	3 cut(s)	217, 284, 379
PshAI	GACNNNNGTC	1 cut(s)	370
Psp6I	CCWGG	2 cut(s)	42, 260
PspGI	CCWGG	2 cut(s)	42, 260
PspN4I	GGNNCC	2 cut(s)	259, 493
PspPI	GGNCC	1 cut(s)	491
PsuI	RGATCY	1 cut(s)	39
RsaI	GTAC	1 cut(s)	325
RsaNI	GTAC	1 cut(s)	324
RseI	CAYNNNNRTG	1 cut(s)	444
Sau3AI	GATC	3 cut(s)	39, 141, 471
Sau96I	GGNCC	1 cut(s)	491
SchI	GAGTC	3 cut(s)	217, 285, 380
ScrFI	CCNGG	2 cut(s)	44, 262
SetI	ASST	7 cut(s)	48, 75, 92, 175, 184, 246, 354
SfaNI	GCATC	3 cut(s)	106, 274, 470
SinI	GGWCC	1 cut(s)	491
SmiMI	CAYNNNNRTG	1 cut(s)	444
Sse9I	AATT	3 cut(s)	60, 77, 342
SspMI	CTAG	2 cut(s)	273, 294
StyD4I	CCNGG	2 cut(s)	42, 260
TaaI	ACNGT	1 cut(s)	289
TaqI	TCGA	1 cut(s)	144
TasI	AATT	3 cut(s)	60, 77, 342
TscAI	CASTG	2 cut(s)	385, 394
TseFI	GTSAC	1 cut(s)	385
Tsp45I	GTSAC	1 cut(s)	385
TspDTI	ATGAA	3 cut(s)	17, 192, 347
TspRI	CASTG	2 cut(s)	385, 394
VpaK11BI	GGWCC	1 cut(s)	491
XapI	RAATTY	2 cut(s)	77, 342
XcmI	CCANNNNNNNNNTGG	1 cut(s)	50
XspI	CTAG	2 cut(s)	273, 294

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.