Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0024847.1

Orthogroup ID

OG0020474

Physical Location & Seq

Genomic Coordinates Reverse (-)

467 .. 766

Gene Structure 300 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0024847.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 300 bp

atgaagggtttgaagcagaagaaagcacatctgatggagatccaggtgaatggtggcacaattgctcaaaatgttgaatttgcaaagagcttctttgagaagcaaatccctattgatgccgtcttccagaaagatgaaatgattgacatcattggtgtggcaaagggtaagggttatgaaggtgttgttactcgttggggtgtcacccggctttcccgtaagaaccatagggttgtgcgtaaggttgtttgtattggtgcattcctgccagagtttcatttacagttgccaaggctgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000027 GO:0003674 GO:0003676 GO:0003723 GO:0003735 GO:0005198 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0005840 GO:0006412 GO:0006518 GO:0006807 GO:0006996 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009987 GO:0010467 GO:0015934 GO:0016043 GO:0019538 GO:0022607 GO:0022613 GO:0022618 GO:0022625 GO:0022626 GO:0032991 GO:0034622 GO:0034641 GO:0034645 GO:0042254 GO:0042255 GO:0042273 GO:0043043 GO:0043170 GO:0043226 GO:0043228 GO:0043229 GO:0043232 GO:0043603 GO:0043604 GO:0043933 GO:0044085 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044267 GO:0044271 GO:0044391 GO:0044422 GO:0044424 GO:0044444 GO:0044445 GO:0044446 GO:0044464 GO:0065003 GO:0070925 GO:0071704 GO:0071826 GO:0071840 GO:0097159 GO:1901363 GO:1901564 GO:1901566 GO:1901576 GO:1990904

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_L3

Protein Analysis

99

Amino Acids

11.23

Weight (kDa)

10.0

Isoelectric Point (pI)

19.11

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020474)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0361591 RchiOBHm_Chr1g0361651
rosa_multiflora	Rmu_co8334785.1_g000001 Rmu_sc0003426.1_g000008 Rmu_sc0010981.1_g000001 Rmu_sc0024847.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	34
AcsI	RAATTY	1 cut(s)	77
AgsI	TTSAA	2 cut(s)	13, 77
AjnI	CCWGG	1 cut(s)	42
AluBI	AGCT	1 cut(s)	90
AluI	AGCT	1 cut(s)	90
AlwI	GGATC	1 cut(s)	34
ApoI	RAATTY	1 cut(s)	77
AsuC2I	CCSGG	1 cut(s)	208
AsuHPI	GGTGA	2 cut(s)	58, 196
BbsI	GAAGAC	1 cut(s)	115
BccI	CCATC	1 cut(s)	28
BceAI	ACGGC	1 cut(s)	104
BciT130I	CCWGG	1 cut(s)	44
BcnI	CCSGG	1 cut(s)	208
Bme1390I	CCNGG	2 cut(s)	44, 208
BmrFI	CCNGG	2 cut(s)	44, 208
BmsI	GCATC	1 cut(s)	106
BpiI	GAAGAC	1 cut(s)	115
BpuMI	CCSGG	1 cut(s)	208
BsaBI	GATNNNNATC	2 cut(s)	38, 146
BsaJI	CCNNGG	1 cut(s)	290
Bse8I	GATNNNNATC	2 cut(s)	38, 146
BseBI	CCWGG	1 cut(s)	44
BseDI	CCNNGG	1 cut(s)	290
BseJI	GATNNNNATC	2 cut(s)	38, 146
BsiSI	CCGG	1 cut(s)	208
BsmI	GAATGC	1 cut(s)	260
Bsp143I	GATC	1 cut(s)	39
BspPI	GGATC	1 cut(s)	34
BssECI	CCNNGG	1 cut(s)	290
BssMI	GATC	1 cut(s)	39
BssT1I	CCWWGG	1 cut(s)	290
Bst2UI	CCWGG	1 cut(s)	44
Bst4CI	ACNGT	1 cut(s)	285
BstKTI	GATC	1 cut(s)	42
BstMBI	GATC	1 cut(s)	39
BstNI	CCWGG	1 cut(s)	44
BstSCI	CCNGG	2 cut(s)	42, 206
BstV2I	GAAGAC	1 cut(s)	115
BstX2I	RGATCY	1 cut(s)	39
BstXI	CCANNNNNNTGG	1 cut(s)	50
BstYI	RGATCY	1 cut(s)	39
CviJI	RGCY	3 cut(s)	90, 211, 295
CviKI_1	RGCY	3 cut(s)	90, 211, 295
DpnI	GATC	1 cut(s)	41
DpnII	GATC	1 cut(s)	39
Eco130I	CCWWGG	1 cut(s)	290
EcoRII	CCWGG	1 cut(s)	42
EcoT14I	CCWWGG	1 cut(s)	290
ErhI	CCWWGG	1 cut(s)	290
FaiI	YATR	2 cut(s)	177, 228
FalI	AAGNNNNNCTT	2 cut(s)	77, 109
HapII	CCGG	1 cut(s)	208
HpaII	CCGG	1 cut(s)	208
HphI	GGTGA	2 cut(s)	58, 196
Hpy188I	TCNGA	1 cut(s)	33
Hpy188III	TCNNGA	1 cut(s)	127
HpyAV	CCTTC	1 cut(s)	173
HpyCH4III	ACNGT	1 cut(s)	285
HpyCH4V	TGCA	2 cut(s)	83, 260
Kzo9I	GATC	1 cut(s)	39
LpnPI	CCDG	6 cut(s)	29, 56, 140, 221, 278, 282
LweI	GCATC	1 cut(s)	106
MaeIII	GTNAC	2 cut(s)	187, 202
MalI	GATC	1 cut(s)	41
MboI	GATC	1 cut(s)	39
MboII	GAAGA	2 cut(s)	31, 115
MfeI	CAATTG	1 cut(s)	60
MflI	RGATCY	1 cut(s)	39
MluCI	AATT	2 cut(s)	60, 77
MslI	CAYNNNNRTG	1 cut(s)	155
MspI	CCGG	1 cut(s)	208
MspR9I	CCNGG	2 cut(s)	44, 208
MunI	CAATTG	1 cut(s)	60
Mva1269I	GAATGC	1 cut(s)	260
MvaI	CCWGG	1 cut(s)	44
NciI	CCSGG	1 cut(s)	208
NdeII	GATC	1 cut(s)	39
NmuCI	GTSAC	1 cut(s)	202
PctI	GAATGC	1 cut(s)	260
Psp6I	CCWGG	1 cut(s)	42
PspGI	CCWGG	1 cut(s)	42
PsuI	RGATCY	1 cut(s)	39
RseI	CAYNNNNRTG	1 cut(s)	155
Sau3AI	GATC	1 cut(s)	39
ScrFI	CCNGG	2 cut(s)	44, 208
SetI	ASST	4 cut(s)	48, 92, 184, 246
SfaNI	GCATC	1 cut(s)	106
SgeI	CNNG	9 cut(s)	55, 56, 139, 204, 219, 220, 228, 277, 281
SmiMI	CAYNNNNRTG	1 cut(s)	155
Sse9I	AATT	2 cut(s)	60, 77
StyD4I	CCNGG	2 cut(s)	42, 206
StyI	CCWWGG	1 cut(s)	290
TaaI	ACNGT	1 cut(s)	285
TasI	AATT	2 cut(s)	60, 77
TseFI	GTSAC	1 cut(s)	202
Tsp45I	GTSAC	1 cut(s)	202
TspDTI	ATGAA	4 cut(s)	17, 150, 192, 266
XapI	RAATTY	1 cut(s)	77
XcmI	CCANNNNNNNNNTGG	1 cut(s)	50

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.