Rmu_sc0003426.1_g000008

Belongs to the universal ribosomal protein uL3 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003426.1
Physical Location & Seq
Reverse (-)
40645 .. 42262
1618 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003426.1_g000008.1.cds

Sequence Viewer

Length: 603 bp
atgaagggtttgaagcagaagaaagcacatctcatggagatccaggtgaatggtggcacaattgctcaaaatgttgaatttgcaaagagcttctttgagaagcaaatccctattgctgccgtcttccagacagatgaaatgattgacatcattggtgtggcaaagggtaagggttatgaaggtgttgttactcgttggggtgtcacccggctttcccttattcgagttttggctcacactcagatcaggaagatgaagggtttgaagcagaagaaagcacatctcatggagatccaggtgaatggtggcacaattgctcaaaatgttgaatttgcaaagagcttctttgagaagcaaatccctattgctgccgtcttccagacagatgaaatgattgacatcattggtgtggcaaagggtaagggttatgaaggtgttgttactcgttggggtgtcacccggctttccctcctgcaaaaacgcaacacaatacacatgactggatcactaataataattgaaattgatggtgttctggttccggagatggatcacctggtagctcacgaggctcgtgcttgcacagatcgatttcagggatga

Protein Analysis

200

Amino Acids

22.24

Weight (kDa)

9.55

Isoelectric Point (pI)

22.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 541
AclWI GGATC 4 cut(s) 34, 286, 511, 558
AcsI RAATTY 2 cut(s) 77, 329
AgsI TTSAA 5 cut(s) 13, 77, 265, 329, 521
AjnI CCWGG 3 cut(s) 42, 294, 555
AluBI AGCT 3 cut(s) 90, 342, 563
AluI AGCT 3 cut(s) 90, 342, 563
AlwI GGATC 4 cut(s) 34, 286, 511, 558
Aor13HI TCCGGA 1 cut(s) 541
ApeKI GCWGC 2 cut(s) 116, 368
ApoI RAATTY 2 cut(s) 77, 329
AsuC2I CCSGG 2 cut(s) 208, 460
AsuHPI GGTGA 5 cut(s) 58, 196, 310, 448, 545
BauI CACGAG 2 cut(s) 566, 573
BbsI GAAGAC 2 cut(s) 115, 367
BbvI GCAGC 2 cut(s) 103, 355
BccI CCATC 2 cut(s) 521, 541
BceAI ACGGC 2 cut(s) 104, 356
BcgI CGANNNNNNTGC 2 cut(s) 557, 591
BciT130I CCWGG 3 cut(s) 44, 296, 557
BcnI CCSGG 2 cut(s) 208, 460
BisI GCNGC 2 cut(s) 117, 369
BlsI GCNGC 2 cut(s) 118, 370
Bme1390I CCNGG 5 cut(s) 44, 208, 296, 460, 557
BmiI GGNNCC 1 cut(s) 540
BmrFI CCNGG 5 cut(s) 44, 208, 296, 460, 557
BpiI GAAGAC 2 cut(s) 115, 367
BpuMI CCSGG 2 cut(s) 208, 460
Bsa29I ATCGAT 1 cut(s) 589
BsaBI GATNNNNATC 2 cut(s) 146, 398
BsaWI WCCGGW 1 cut(s) 541
Bse1I ACTGG 1 cut(s) 505
Bse8I GATNNNNATC 2 cut(s) 146, 398
BseAI TCCGGA 1 cut(s) 541
BseBI CCWGG 3 cut(s) 44, 296, 557
BseCI ATCGAT 1 cut(s) 589
BseJI GATNNNNATC 2 cut(s) 146, 398
BseMII CTCAG 1 cut(s) 254
BseNI ACTGG 1 cut(s) 505
BseXI GCAGC 2 cut(s) 103, 355
BshVI ATCGAT 1 cut(s) 589
BsiSI CCGG 3 cut(s) 208, 460, 542
Bsp13I TCCGGA 1 cut(s) 541
Bsp143I GATC 6 cut(s) 39, 243, 291, 503, 550, 586
BspCNI CTCAG 1 cut(s) 253
BspDI ATCGAT 1 cut(s) 589
BspEI TCCGGA 1 cut(s) 541
BspLI GGNNCC 1 cut(s) 540
BspPI GGATC 4 cut(s) 34, 286, 511, 558
BsrI ACTGG 1 cut(s) 505
BssMI GATC 6 cut(s) 39, 243, 291, 503, 550, 586
BssSI CACGAG 2 cut(s) 566, 573
Bst2BI CACGAG 2 cut(s) 566, 573
Bst2UI CCWGG 3 cut(s) 44, 296, 557
BstC8I GCNNGC 1 cut(s) 580
BstDEI CTNAG 1 cut(s) 240
BstKTI GATC 6 cut(s) 42, 246, 294, 506, 553, 589
BstMBI GATC 6 cut(s) 39, 243, 291, 503, 550, 586
BstMWI GCNNNNNNNGC 1 cut(s) 569
BstNI CCWGG 3 cut(s) 44, 296, 557
BstSCI CCNGG 5 cut(s) 42, 206, 294, 458, 555
BstV1I GCAGC 2 cut(s) 103, 355
BstV2I GAAGAC 2 cut(s) 115, 367
BstX2I RGATCY 2 cut(s) 39, 291
BstXI CCANNNNNNTGG 2 cut(s) 50, 302
BstYI RGATCY 2 cut(s) 39, 291
Bsu15I ATCGAT 1 cut(s) 589
BsuTUI ATCGAT 1 cut(s) 589
Cac8I GCNNGC 1 cut(s) 580
ClaI ATCGAT 1 cut(s) 589
CsiI ACCWGGT 1 cut(s) 555
CviAII CATG 3 cut(s) 34, 286, 496
CviJI RGCY 7 cut(s) 90, 211, 233, 342, 463, 563, 572
CviKI_1 RGCY 7 cut(s) 90, 211, 233, 342, 463, 563, 572
DdeI CTNAG 1 cut(s) 240
DpnI GATC 6 cut(s) 41, 245, 293, 505, 552, 588
DpnII GATC 6 cut(s) 39, 243, 291, 503, 550, 586
EcoRII CCWGG 3 cut(s) 42, 294, 555
FaeI CATG 3 cut(s) 37, 289, 499
FaiI YATR 5 cut(s) 35, 177, 287, 429, 497
FalI AAGNNNNNCTT 4 cut(s) 77, 109, 329, 361
FatI CATG 3 cut(s) 33, 285, 495
Fnu4HI GCNGC 2 cut(s) 117, 369
Fsp4HI GCNGC 2 cut(s) 117, 369
GluI GCNGC 2 cut(s) 117, 369
HapII CCGG 3 cut(s) 208, 460, 542
Hin1II CATG 3 cut(s) 37, 289, 499
HpaII CCGG 3 cut(s) 208, 460, 542
HphI GGTGA 5 cut(s) 58, 196, 310, 448, 545
Hpy188I TCNGA 1 cut(s) 243
Hpy188III TCNNGA 5 cut(s) 127, 247, 379, 542, 566
HpyAV CCTTC 3 cut(s) 173, 250, 425
HpyCH4V TGCA 4 cut(s) 83, 335, 475, 582
HpyF10VI GCNNNNNNNGC 1 cut(s) 569
HpyF3I CTNAG 1 cut(s) 240
Hsp92II CATG 3 cut(s) 37, 289, 499
Kpn2I TCCGGA 1 cut(s) 541
Kzo9I GATC 6 cut(s) 39, 243, 291, 503, 550, 586
Lsp1109I GCAGC 2 cut(s) 103, 355
MabI ACCWGGT 1 cut(s) 555
MaeIII GTNAC 4 cut(s) 187, 202, 439, 454
MalI GATC 6 cut(s) 41, 245, 293, 505, 552, 588
MboI GATC 6 cut(s) 39, 243, 291, 503, 550, 586
MboII GAAGA 5 cut(s) 31, 115, 262, 283, 367
MfeI CAATTG 2 cut(s) 60, 312
MflI RGATCY 2 cut(s) 39, 291
MluCI AATT 6 cut(s) 60, 77, 312, 329, 516, 522
MnlI CCTC 2 cut(s) 479, 562
MroI TCCGGA 1 cut(s) 541
MslI CAYNNNNRTG 2 cut(s) 155, 407
MspI CCGG 3 cut(s) 208, 460, 542
MspR9I CCNGG 5 cut(s) 44, 208, 296, 460, 557
MunI CAATTG 2 cut(s) 60, 312
MvaI CCWGG 3 cut(s) 44, 296, 557
MwoI GCNNNNNNNGC 1 cut(s) 569
NciI CCSGG 2 cut(s) 208, 460
NdeII GATC 6 cut(s) 39, 243, 291, 503, 550, 586
NlaIII CATG 3 cut(s) 37, 289, 499
NlaIV GGNNCC 1 cut(s) 540
NmuCI GTSAC 2 cut(s) 202, 454
PkrI GCNGC 2 cut(s) 118, 370
Psp6I CCWGG 3 cut(s) 42, 294, 555
PspGI CCWGG 3 cut(s) 42, 294, 555
PspN4I GGNNCC 1 cut(s) 540
PsuI RGATCY 2 cut(s) 39, 291
RseI CAYNNNNRTG 2 cut(s) 155, 407
SatI GCNGC 2 cut(s) 117, 369
Sau3AI GATC 6 cut(s) 39, 243, 291, 503, 550, 586
ScrFI CCNGG 5 cut(s) 44, 208, 296, 460, 557
SetI ASST 8 cut(s) 48, 92, 184, 300, 344, 436, 558, 565
SexAI ACCWGGT 1 cut(s) 555
SmiMI CAYNNNNRTG 2 cut(s) 155, 407
Sse9I AATT 6 cut(s) 60, 77, 312, 329, 516, 522
StyD4I CCNGG 5 cut(s) 42, 206, 294, 458, 555
TaqI TCGA 2 cut(s) 223, 589
TasI AATT 6 cut(s) 60, 77, 312, 329, 516, 522
TseFI GTSAC 2 cut(s) 202, 454
TseI GCWGC 2 cut(s) 116, 368
Tsp45I GTSAC 2 cut(s) 202, 454
TspDTI ATGAA 6 cut(s) 17, 150, 192, 269, 402, 444
XapI RAATTY 2 cut(s) 77, 329
XcmI CCANNNNNNNNNTGG 2 cut(s) 50, 302
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.