Rmu_co8405031.1_g000001

Belongs to the ATG8 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8405031.1
Physical Location & Seq
Reverse (-)
70 .. 321
252 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8405031.1_g000001.1.cds

Sequence Viewer

Length: 252 bp
atgttgaagcaagccagtgaaactttcatcagcggtaatggccataccaggggggacttcaagcgcagacgttctctagggccgaggcgagccgaaaaagtgcgtatcagggagaagtatcctgatagaatacctgtgattgtggagaaagctatattcaccaacattcctaacattgccaaggacaaattccttatccctcccactacaagaaatcatgtcataagcaaggaaaatatctgcgacgattaa
Functional Annotation

Protein Analysis

83

Amino Acids

9.6

Weight (kDa)

10.27

Isoelectric Point (pI)

55.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019128)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0474721
rosa_multiflora Rmu_co8405031.1_g000001
rosa_roxburghii Rroxscaffold_6G00406940
rosa_rugosa Rorug03G0142900
rosa_samantha Rh3AG193200 Rh3BG223000 Rh3CG217800 Rh3DG219000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 33
AcoI YGGCCR 1 cut(s) 40
AcsI RAATTY 1 cut(s) 188
AfiI CCNNNNNNNGG 1 cut(s) 49
AgsI TTSAA 2 cut(s) 7, 61
AjnI CCWGG 1 cut(s) 47
AjuI GAANNNNNNNTTGG 2 cut(s) 173, 205
AluBI AGCT 1 cut(s) 152
AluI AGCT 1 cut(s) 152
AoxI GGCC 2 cut(s) 40, 80
ApoI RAATTY 1 cut(s) 188
AspLEI GCGC 1 cut(s) 66
AspS9I GGNCC 1 cut(s) 80
AsuHPI GGTGA 1 cut(s) 151
BalI TGGCCA 1 cut(s) 42
BciT130I CCWGG 1 cut(s) 49
BciVI GTATCC 1 cut(s) 129
BfaI CTAG 1 cut(s) 77
BfuI GTATCC 1 cut(s) 129
Bme1390I CCNGG 1 cut(s) 49
BmgT120I GGNCC 1 cut(s) 80
BmrFI CCNGG 1 cut(s) 49
BsaJI CCNNGG 3 cut(s) 48, 83, 180
Bsc4I CCNNNNNNNGG 1 cut(s) 49
Bse1I ACTGG 1 cut(s) 15
Bse3DI GCAATG 1 cut(s) 174
BseBI CCWGG 1 cut(s) 49
BseDI CCNNGG 3 cut(s) 48, 83, 180
BseLI CCNNNNNNNGG 1 cut(s) 49
BseMI GCAATG 1 cut(s) 174
BseNI ACTGG 1 cut(s) 15
BshFI GGCC 2 cut(s) 42, 82
BslFI GGGAC 1 cut(s) 68
BslI CCNNNNNNNGG 1 cut(s) 49
BsmFI GGGAC 1 cut(s) 68
BsnI GGCC 2 cut(s) 42, 82
BspACI CCGC 1 cut(s) 33
BspANI GGCC 2 cut(s) 42, 82
BsrDI GCAATG 1 cut(s) 174
BsrI ACTGG 1 cut(s) 15
BssECI CCNNGG 3 cut(s) 48, 83, 180
BssT1I CCWWGG 1 cut(s) 180
Bst2UI CCWGG 1 cut(s) 49
BstC8I GCNNGC 2 cut(s) 12, 90
BstHHI GCGC 1 cut(s) 66
BstMWI GCNNNNNNNGC 1 cut(s) 39
BstNI CCWGG 1 cut(s) 49
BstSCI CCNGG 1 cut(s) 47
BsuI GTATCC 1 cut(s) 129
BsuRI GGCC 2 cut(s) 42, 82
BtsIMutI CAGTG 1 cut(s) 22
Cac8I GCNNGC 2 cut(s) 12, 90
CfoI GCGC 1 cut(s) 66
Cfr13I GGNCC 1 cut(s) 80
CviAII CATG 1 cut(s) 218
CviJI RGCY 5 cut(s) 14, 42, 82, 92, 152
CviKI_1 RGCY 5 cut(s) 14, 42, 82, 92, 152
EaeI YGGCCR 1 cut(s) 40
Eco130I CCWWGG 1 cut(s) 180
EcoRII CCWGG 1 cut(s) 47
EcoT14I CCWWGG 1 cut(s) 180
ErhI CCWWGG 1 cut(s) 180
FaeI CATG 1 cut(s) 221
FaiI YATR 4 cut(s) 45, 155, 219, 224
FaqI GGGAC 1 cut(s) 68
FatI CATG 1 cut(s) 217
FspBI CTAG 1 cut(s) 77
GlaI GCGC 1 cut(s) 65
HaeIII GGCC 2 cut(s) 42, 82
HhaI GCGC 1 cut(s) 66
Hin1II CATG 1 cut(s) 221
Hin6I GCGC 1 cut(s) 64
HinP1I GCGC 1 cut(s) 64
HphI GGTGA 1 cut(s) 151
Hpy188III TCNNGA 1 cut(s) 122
Hpy99I CGWCG 1 cut(s) 248
HpyCH4IV ACGT 1 cut(s) 70
HpyF10VI GCNNNNNNNGC 1 cut(s) 39
HpySE526I ACGT 1 cut(s) 70
Hsp92II CATG 1 cut(s) 221
HspAI GCGC 1 cut(s) 64
LpnPI CCDG 6 cut(s) 28, 34, 61, 94, 135, 147
MaeI CTAG 1 cut(s) 77
MaeII ACGT 1 cut(s) 70
MlsI TGGCCA 1 cut(s) 42
MluCI AATT 1 cut(s) 188
MluNI TGGCCA 1 cut(s) 42
MnlI CCTC 2 cut(s) 78, 210
Mox20I TGGCCA 1 cut(s) 42
MscI TGGCCA 1 cut(s) 42
MseI TTAA 1 cut(s) 250
Msp20I TGGCCA 1 cut(s) 42
MspA1I CMGCKG 1 cut(s) 33
MspR9I CCNGG 1 cut(s) 49
MvaI CCWGG 1 cut(s) 49
MwoI GCNNNNNNNGC 1 cut(s) 39
NlaIII CATG 1 cut(s) 221
NmeAIII GCCGAG 1 cut(s) 108
Psp6I CCWGG 1 cut(s) 47
PspGI CCWGG 1 cut(s) 47
PspPI GGNCC 1 cut(s) 80
SaqAI TTAA 1 cut(s) 250
Sau96I GGNCC 1 cut(s) 80
ScrFI CCNGG 1 cut(s) 49
SetI ASST 3 cut(s) 73, 136, 154
Sse9I AATT 1 cut(s) 188
SsiI CCGC 1 cut(s) 33
SspMI CTAG 1 cut(s) 77
StyD4I CCNGG 1 cut(s) 47
StyI CCWWGG 1 cut(s) 180
TaiI ACGT 1 cut(s) 73
TasI AATT 1 cut(s) 188
Tru1I TTAA 1 cut(s) 250
Tru9I TTAA 1 cut(s) 250
TscAI CASTG 1 cut(s) 22
TspDTI ATGAA 1 cut(s) 16
TspRI CASTG 1 cut(s) 22
XapI RAATTY 1 cut(s) 188
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.