Rmu_co8431667.1_g000001

methyltransferase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8431667.1
OG0018029
Physical Location & Seq
Forward (+)
30 .. 776
747 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8431667.1_g000001.1.cds

Sequence Viewer

Length: 747 bp
atgtacagcgcagtgtactggctttactacaccgggtacagttccgaaaaggtggactgtagtaactatccggttggtcaatgttcagtggacccgtttaagtctctgcccggactggcttgcagccaggacgggcgaaactgggccaggattgaaggggattatcatagtggtgccttgctcgacgtagggtccaaaaatgagtgggactcttcgttcattgcaaaacctcaagtggttgtgcatggcggcgatgacatgagaatgtattatcattcgtttgatacagaaaacggtcactttggcattgggttggcgagatccagggacggaataaggtgggtgaaattggggaaaattattgggggaggggcaaaagggtcatttgacgagcttggggtgaaaaatgcttgtgtggttaggaacaggaaggaagggaactacttaatggcgtatgagggtgtgagcgcggatgggaagatgagtattggtctggctgtatcccccgatgggctgaaggactggaccagagtccaagacaggtcagttctcagcccatcagaagaagacggatgggacaacagaggagtgggatccccgagtctggtgcatatggaaggcaatgtagacatgtggcgattgtattatgtgggtgttggagaagatggaaggactgggattgggatggcgatttcggaaggtagtaacgtcagaaacttcagaaggtgggcagggtttcaatcgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

248

Amino Acids

27.31

Weight (kDa)

5.76

Isoelectric Point (pI)

42.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018029)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g30990
rosa_chinensis RchiOBHm_Chr4g0439361
rosa_laevigata RLG00000006276
rosa_multiflora Rmu_co8431667.1_g000001 Rmu_sc0004012.1_g000003
rosa_roxburghii Rroxscaffold_5G00380290
rosa_samantha Rh4AG368800 Rh4BG380600 Rh4CG395100 Rh4DG375400
rosa_wichuraiana Rw4G031450

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 173
AccI GTMKAC 1 cut(s) 627
AccII CGCG 1 cut(s) 470
AciI CCGC 2 cut(s) 249, 470
AclWI GGATC 3 cut(s) 315, 588, 601
AcuI CTGAAG 2 cut(s) 536, 703
AfaI GTAC 3 cut(s) 5, 17, 38
AfiI CCNNNNNNNGG 2 cut(s) 510, 604
AflIII ACRYGT 1 cut(s) 630
AgsI TTSAA 2 cut(s) 155, 740
AhdI GACNNNNNGTC 1 cut(s) 190
AjnI CCWGG 3 cut(s) 126, 146, 323
AloI GAACNNNNNNTCC 2 cut(s) 200, 232
AluBI AGCT 1 cut(s) 394
AluI AGCT 1 cut(s) 394
Alw26I GTCTC 1 cut(s) 108
AlwI GGATC 3 cut(s) 315, 588, 601
Ama87I CYCGRG 1 cut(s) 598
AoxI GGCC 1 cut(s) 144
ApeKI GCWGC 1 cut(s) 123
AspLEI GCGC 2 cut(s) 11, 470
AspS9I GGNCC 4 cut(s) 91, 144, 192, 525
AsuC2I CCSGG 2 cut(s) 34, 111
AsuHPI GGTGA 2 cut(s) 355, 412
AvaI CYCGRG 1 cut(s) 598
AvaII GGWCC 3 cut(s) 91, 192, 525
BamHI GGATCC 1 cut(s) 593
BanI GGYRCC 1 cut(s) 173
BbsI GAAGAC 1 cut(s) 573
BbvI GCAGC 1 cut(s) 135
BccI CCATC 6 cut(s) 467, 503, 565, 567, 659, 679
BcgI CGANNNNNNTGC 2 cut(s) 589, 623
BciT130I CCWGG 3 cut(s) 128, 148, 325
BciVI GTATCC 1 cut(s) 511
BcnI CCSGG 2 cut(s) 34, 111
BcoDI GTCTC 1 cut(s) 108
BfmI CTRYAG 1 cut(s) 58
BfuI GTATCC 1 cut(s) 511
BisI GCNGC 2 cut(s) 124, 250
BlsI GCNGC 2 cut(s) 125, 251
Bme1390I CCNGG 5 cut(s) 34, 111, 128, 148, 325
Bme18I GGWCC 3 cut(s) 91, 192, 525
BmeRI GACNNNNNGTC 1 cut(s) 190
BmeT110I CYCGRG 1 cut(s) 598
BmgT120I GGNCC 4 cut(s) 91, 144, 192, 525
BmiI GGNNCC 4 cut(s) 93, 175, 193, 595
BmrFI CCNGG 5 cut(s) 34, 111, 128, 148, 325
BmrI ACTGGG 2 cut(s) 151, 684
BmuI ACTGGG 2 cut(s) 151, 684
BoxI GACNNNNGTC 1 cut(s) 530
BpiI GAAGAC 1 cut(s) 573
BplI GAGNNNNNCTC 2 cut(s) 194, 226
BpuEI CTTGAG 1 cut(s) 216
BpuMI CCSGG 2 cut(s) 34, 111
BsaJI CCNNGG 1 cut(s) 324
BsaWI WCCGGW 1 cut(s) 70
Bsc4I CCNNNNNNNGG 2 cut(s) 510, 604
Bse1I ACTGG 5 cut(s) 23, 120, 146, 527, 679
Bse3DI GCAATG 2 cut(s) 219, 628
BseBI CCWGG 3 cut(s) 128, 148, 325
BseDI CCNNGG 1 cut(s) 324
BseGI GGATG 3 cut(s) 478, 578, 690
BseLI CCNNNNNNNGG 2 cut(s) 510, 604
BseMI GCAATG 2 cut(s) 219, 628
BseMII CTCAG 1 cut(s) 565
BseNI ACTGG 5 cut(s) 23, 120, 146, 527, 679
BseRI GAGGAG 1 cut(s) 600
BseXI GCAGC 1 cut(s) 135
Bsh1236I CGCG 1 cut(s) 470
BshFI GGCC 1 cut(s) 146
BshNI GGYRCC 1 cut(s) 173
BsiHKCI CYCGRG 1 cut(s) 598
BsiSI CCGG 3 cut(s) 33, 71, 111
BslFI GGGAC 3 cut(s) 221, 341, 590
BslI CCNNNNNNNGG 2 cut(s) 510, 604
BsmAI GTCTC 1 cut(s) 108
BsmFI GGGAC 3 cut(s) 221, 341, 590
BsnI GGCC 1 cut(s) 146
BsoBI CYCGRG 1 cut(s) 598
Bsp1407I TGTACA 1 cut(s) 3
Bsp143I GATC 2 cut(s) 320, 593
BspACI CCGC 2 cut(s) 249, 470
BspANI GGCC 1 cut(s) 146
BspCNI CTCAG 1 cut(s) 564
BspFNI CGCG 1 cut(s) 470
BspLI GGNNCC 4 cut(s) 93, 175, 193, 595
BspPI GGATC 3 cut(s) 315, 588, 601
BspT107I GGYRCC 1 cut(s) 173
BsrDI GCAATG 2 cut(s) 219, 628
BsrGI TGTACA 1 cut(s) 3
BsrI ACTGG 5 cut(s) 23, 120, 146, 527, 679
BssECI CCNNGG 1 cut(s) 324
BssMI GATC 2 cut(s) 320, 593
Bst2UI CCWGG 3 cut(s) 128, 148, 325
Bst4CI ACNGT 3 cut(s) 41, 59, 296
Bst6I CTCTTC 1 cut(s) 217
BstAUI TGTACA 1 cut(s) 3
BstC8I GCNNGC 1 cut(s) 121
BstDEI CTNAG 1 cut(s) 551
BstF5I GGATG 3 cut(s) 478, 578, 690
BstFNI CGCG 1 cut(s) 470
BstHHI GCGC 2 cut(s) 11, 470
BstKTI GATC 2 cut(s) 323, 596
BstMAI GTCTC 1 cut(s) 108
BstMBI GATC 2 cut(s) 320, 593
BstNI CCWGG 3 cut(s) 128, 148, 325
BstNSI RCATGY 1 cut(s) 634
BstPAI GACNNNNGTC 1 cut(s) 530
BstSCI CCNGG 5 cut(s) 32, 109, 126, 146, 323
BstSFI CTRYAG 1 cut(s) 58
BstUI CGCG 1 cut(s) 470
BstV1I GCAGC 1 cut(s) 135
BstV2I GAAGAC 1 cut(s) 573
BstX2I RGATCY 2 cut(s) 320, 593
BstYI RGATCY 2 cut(s) 320, 593
BsuI GTATCC 1 cut(s) 511
BsuRI GGCC 1 cut(s) 146
BtgZI GCGATG 1 cut(s) 267
BtsCI GGATG 3 cut(s) 478, 578, 690
BtsI GCAGTG 1 cut(s) 18
BtsIMutI CAGTG 2 cut(s) 18, 93
Cac8I GCNNGC 1 cut(s) 121
CfoI GCGC 2 cut(s) 11, 470
Cfr13I GGNCC 4 cut(s) 91, 144, 192, 525
Csp6I GTAC 3 cut(s) 4, 16, 37
CviAII CATG 3 cut(s) 245, 259, 631
CviJI RGCY 8 cut(s) 22, 119, 126, 146, 394, 497, 514, 555
CviKI_1 RGCY 8 cut(s) 22, 119, 126, 146, 394, 497, 514, 555
CviQI GTAC 3 cut(s) 4, 16, 37
DdeI CTNAG 1 cut(s) 551
DpnI GATC 2 cut(s) 322, 595
DpnII GATC 2 cut(s) 320, 593
DriI GACNNNNNGTC 1 cut(s) 190
Eam1104I CTCTTC 1 cut(s) 217
Eam1105I GACNNNNNGTC 1 cut(s) 190
EarI CTCTTC 1 cut(s) 217
Eco47I GGWCC 3 cut(s) 91, 192, 525
Eco57I CTGAAG 2 cut(s) 536, 703
Eco88I CYCGRG 1 cut(s) 598
EcoRII CCWGG 3 cut(s) 126, 146, 323
FaeI CATG 3 cut(s) 248, 262, 634
FaiI YATR 8 cut(s) 168, 246, 260, 456, 612, 614, 632, 648
FaqI GGGAC 3 cut(s) 221, 341, 590
FatI CATG 3 cut(s) 244, 258, 630
FauNDI CATATG 1 cut(s) 612
FblI GTMKAC 1 cut(s) 627
Fnu4HI GCNGC 2 cut(s) 124, 250
FokI GGATG 3 cut(s) 485, 585, 697
Fsp4HI GCNGC 2 cut(s) 124, 250
GlaI GCGC 2 cut(s) 10, 469
GluI GCNGC 2 cut(s) 124, 250
HaeIII GGCC 1 cut(s) 146
HapII CCGG 3 cut(s) 33, 71, 111
HhaI GCGC 2 cut(s) 11, 470
Hin1II CATG 3 cut(s) 248, 262, 634
Hin6I GCGC 2 cut(s) 9, 468
HinP1I GCGC 2 cut(s) 9, 468
HinfI GANTC 3 cut(s) 209, 531, 601
HpaII CCGG 3 cut(s) 33, 71, 111
HphI GGTGA 2 cut(s) 355, 412
Hpy166II GTNNAC 4 cut(s) 16, 55, 91, 628
Hpy188I TCNGA 5 cut(s) 46, 562, 697, 713, 722
Hpy8I GTNNAC 4 cut(s) 16, 55, 91, 628
Hpy99I CGWCG 1 cut(s) 188
HpyAV CCTTC 8 cut(s) 149, 424, 428, 511, 611, 663, 692, 717
HpyCH4III ACNGT 3 cut(s) 41, 59, 296
HpyCH4IV ACGT 2 cut(s) 186, 708
HpyCH4V TGCA 4 cut(s) 123, 224, 244, 610
HpyF3I CTNAG 1 cut(s) 551
HpySE526I ACGT 2 cut(s) 186, 708
Hsp92II CATG 3 cut(s) 248, 262, 634
HspAI GCGC 2 cut(s) 9, 468
Kzo9I GATC 2 cut(s) 320, 593
Lsp1109I GCAGC 1 cut(s) 135
MaeII ACGT 2 cut(s) 186, 708
MaeIII GTNAC 3 cut(s) 62, 296, 704
MalI GATC 2 cut(s) 322, 595
MboI GATC 2 cut(s) 320, 593
MboII GAAGA 5 cut(s) 204, 490, 575, 578, 674
MflI RGATCY 2 cut(s) 320, 593
MluCI AATT 2 cut(s) 347, 357
MlyI GAGTC 3 cut(s) 203, 540, 610
MmeI TCCRAC 1 cut(s) 637
MnlI CCTC 4 cut(s) 240, 362, 451, 578
MseI TTAA 2 cut(s) 99, 446
MslI CAYNNNNRTG 2 cut(s) 171, 263
MspI CCGG 3 cut(s) 33, 71, 111
MspR9I CCNGG 5 cut(s) 34, 111, 128, 148, 325
MvaI CCWGG 3 cut(s) 128, 148, 325
MvnI CGCG 1 cut(s) 470
NciI CCSGG 2 cut(s) 34, 111
NdeI CATATG 1 cut(s) 612
NdeII GATC 2 cut(s) 320, 593
NlaIII CATG 3 cut(s) 248, 262, 634
NlaIV GGNNCC 4 cut(s) 93, 175, 193, 595
NmuCI GTSAC 1 cut(s) 296
NspI RCATGY 1 cut(s) 634
PciI ACATGT 1 cut(s) 630
PkrI GCNGC 2 cut(s) 125, 251
PleI GAGTC 3 cut(s) 203, 539, 609
PpsI GAGTC 3 cut(s) 203, 539, 609
PscI ACATGT 1 cut(s) 630
PshAI GACNNNNGTC 1 cut(s) 530
Psp6I CCWGG 3 cut(s) 126, 146, 323
PspGI CCWGG 3 cut(s) 126, 146, 323
PspN4I GGNNCC 4 cut(s) 93, 175, 193, 595
PspPI GGNCC 4 cut(s) 91, 144, 192, 525
PsuI RGATCY 2 cut(s) 320, 593
RsaI GTAC 3 cut(s) 5, 17, 38
RsaNI GTAC 3 cut(s) 4, 16, 37
RseI CAYNNNNRTG 2 cut(s) 171, 263
SaqAI TTAA 2 cut(s) 99, 446
SatI GCNGC 2 cut(s) 124, 250
Sau3AI GATC 2 cut(s) 320, 593
Sau96I GGNCC 4 cut(s) 91, 144, 192, 525
SchI GAGTC 3 cut(s) 203, 540, 610
ScrFI CCNGG 5 cut(s) 34, 111, 128, 148, 325
SetI ASST 9 cut(s) 54, 189, 232, 341, 396, 545, 703, 711, 728
SfcI CTRYAG 1 cut(s) 58
SinI GGWCC 3 cut(s) 91, 192, 525
SmiMI CAYNNNNRTG 2 cut(s) 171, 263
SmlI CTYRAG 1 cut(s) 231
SmoI CTYRAG 1 cut(s) 231
Sse9I AATT 2 cut(s) 347, 357
SsiI CCGC 2 cut(s) 249, 470
StyD4I CCNGG 5 cut(s) 32, 109, 126, 146, 323
TaaI ACNGT 3 cut(s) 41, 59, 296
TaiI ACGT 2 cut(s) 189, 711
TaqI TCGA 1 cut(s) 183
TasI AATT 2 cut(s) 347, 357
TatI WGTACW 2 cut(s) 3, 15
TauI GCSGC 1 cut(s) 252
Tru1I TTAA 2 cut(s) 99, 446
Tru9I TTAA 2 cut(s) 99, 446
TscAI CASTG 2 cut(s) 18, 93
TseFI GTSAC 1 cut(s) 296
TseI GCWGC 1 cut(s) 123
Tsp45I GTSAC 1 cut(s) 296
TspDTI ATGAA 1 cut(s) 208
TspGWI ACGGA 2 cut(s) 345, 585
TspRI CASTG 2 cut(s) 18, 93
VpaK11BI GGWCC 3 cut(s) 91, 192, 525
XceI RCATGY 1 cut(s) 634
XmiI GTMKAC 1 cut(s) 627
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.