Rmu_sc0000071.1_g000018

Belongs to the complex I LYR family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000071.1
Physical Location & Seq
Reverse (-)
71738 .. 72500
763 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000071.1_g000018.1.cds

Sequence Viewer

Length: 333 bp
atgagtgctgaagctttgcaagttgctaaggcataccgccaccttctcaaagctgtcaagaaccacgttgccaaagaagacactaagcggcatttcagagattatgtaactgaagaatttaggaacaacggcaaactgtcggatctatcttccatccagcagaagattaagctcgcccgtgattacacttatcttctcaacagtgtgcaccatcagaaggacctattgttctcttacaacatagccatagaccgatcagctgaaatgaaaagagtacttggaaagtcggctgcaagtgttggtcttcaacttccagaggtttaccagccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.65

Weight (kDa)

9.62

Isoelectric Point (pI)

38.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014205)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G51960 AT5G51960
fragaria_vesca FvH4_7g20160
malus_domestica MD01G1131200.v1.1 MD07G1179300.v1.1
prunus_persica Prupe.2G218600_v2.0.a1
pyrus_communis pycom07g17300
rosa_chinensis RchiOBHm_Chr1g0364121
rosa_laevigata RLG00000027514
rosa_multiflora Rmu_sc0000071.1_g000018
rosa_roxburghii Rroxscaffold_4G00292620
rosa_rugosa Rorug01G0313700
rosa_samantha Rh1AG321200 Rh1BG284400 Rh1CG300800 Rh1DG315800
rosa_wichuraiana Rw1G028480

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 37, 88
AclWI GGATC 1 cut(s) 150
AcsI RAATTY 1 cut(s) 116
AcuI CTGAAG 2 cut(s) 30, 132
AfaI GTAC 1 cut(s) 276
AfiI CCNNNNNNNGG 1 cut(s) 217
AgsI TTSAA 1 cut(s) 308
AloI GAACNNNNNNTCC 2 cut(s) 212, 244
AluBI AGCT 4 cut(s) 14, 53, 172, 260
AluI AGCT 4 cut(s) 14, 53, 172, 260
Alw21I GWGCWC 1 cut(s) 210
Alw44I GTGCAC 1 cut(s) 206
AlwI GGATC 1 cut(s) 150
ApaLI GTGCAC 1 cut(s) 206
ApeKI GCWGC 1 cut(s) 290
ApoI RAATTY 1 cut(s) 116
AspS9I GGNCC 1 cut(s) 220
AvaII GGWCC 1 cut(s) 220
BaeGI GKGCMC 1 cut(s) 210
BbsI GAAGAC 2 cut(s) 84, 296
Bbv12I GWGCWC 1 cut(s) 210
BbvI GCAGC 1 cut(s) 277
BccI CCATC 2 cut(s) 161, 219
BceAI ACGGC 1 cut(s) 145
BisI GCNGC 2 cut(s) 89, 291
BlsI GCNGC 2 cut(s) 90, 292
BmcAI AGTACT 1 cut(s) 276
Bme18I GGWCC 1 cut(s) 220
BmgT120I GGNCC 1 cut(s) 220
BpiI GAAGAC 2 cut(s) 84, 296
Bpu10I CCTNAGC 1 cut(s) 27
Bsc4I CCNNNNNNNGG 1 cut(s) 217
BseGI GGATG 1 cut(s) 153
BseLI CCNNNNNNNGG 1 cut(s) 217
BseSI GKGCMC 1 cut(s) 210
BseXI GCAGC 1 cut(s) 277
BsiHKAI GWGCWC 1 cut(s) 210
BslI CCNNNNNNNGG 1 cut(s) 217
Bsp1286I GDGCHC 1 cut(s) 210
Bsp143I GATC 2 cut(s) 142, 254
BspACI CCGC 2 cut(s) 37, 88
BspPI GGATC 1 cut(s) 150
BssMI GATC 2 cut(s) 142, 254
Bst4CI ACNGT 2 cut(s) 138, 203
BstC8I GCNNGC 1 cut(s) 174
BstDEI CTNAG 2 cut(s) 27, 84
BstF5I GGATG 1 cut(s) 153
BstKTI GATC 2 cut(s) 145, 257
BstMBI GATC 2 cut(s) 142, 254
BstSLI GKGCMC 1 cut(s) 210
BstV1I GCAGC 1 cut(s) 277
BstV2I GAAGAC 2 cut(s) 84, 296
BstX2I RGATCY 1 cut(s) 142
BstYI RGATCY 1 cut(s) 142
BtsCI GGATG 1 cut(s) 153
BtsIMutI CAGTG 1 cut(s) 208
Cac8I GCNNGC 1 cut(s) 174
Cfr13I GGNCC 1 cut(s) 220
Csp6I GTAC 1 cut(s) 275
CviJI RGCY 7 cut(s) 14, 53, 172, 245, 260, 290, 328
CviKI_1 RGCY 7 cut(s) 14, 53, 172, 245, 260, 290, 328
CviQI GTAC 1 cut(s) 275
DdeI CTNAG 2 cut(s) 27, 84
DpnI GATC 2 cut(s) 144, 256
DpnII GATC 2 cut(s) 142, 254
Eco47I GGWCC 1 cut(s) 220
Eco57I CTGAAG 2 cut(s) 30, 132
EcoO109I RGGNCCY 1 cut(s) 220
FaiI YATR 4 cut(s) 34, 105, 242, 248
Fnu4HI GCNGC 2 cut(s) 89, 291
FokI GGATG 1 cut(s) 140
Fsp4HI GCNGC 2 cut(s) 89, 291
GluI GCNGC 2 cut(s) 89, 291
HindIII AAGCTT 1 cut(s) 12
Hpy166II GTNNAC 2 cut(s) 208, 322
Hpy188I TCNGA 3 cut(s) 98, 142, 216
Hpy188III TCNNGA 2 cut(s) 58, 314
Hpy8I GTNNAC 2 cut(s) 208, 322
HpyAV CCTTC 2 cut(s) 53, 211
HpyCH4III ACNGT 2 cut(s) 138, 203
HpyCH4IV ACGT 1 cut(s) 66
HpyCH4V TGCA 3 cut(s) 19, 208, 293
HpyF3I CTNAG 2 cut(s) 27, 84
HpySE526I ACGT 1 cut(s) 66
Kzo9I GATC 2 cut(s) 142, 254
LpnPI CCDG 2 cut(s) 170, 327
Lsp1109I GCAGC 1 cut(s) 277
MaeII ACGT 1 cut(s) 66
MaeIII GTNAC 1 cut(s) 106
MalI GATC 2 cut(s) 144, 256
MboI GATC 2 cut(s) 142, 254
MboII GAAGA 6 cut(s) 89, 125, 141, 175, 185, 296
MflI RGATCY 1 cut(s) 142
MhlI GDGCHC 1 cut(s) 210
MluCI AATT 1 cut(s) 116
MmeI TCCRAC 1 cut(s) 120
MnlI CCTC 1 cut(s) 310
MseI TTAA 1 cut(s) 168
MspA1I CMGCKG 1 cut(s) 260
NdeII GATC 2 cut(s) 142, 254
PkrI GCNGC 2 cut(s) 90, 292
PpuMI RGGWCCY 1 cut(s) 220
Psp5II RGGWCCY 1 cut(s) 220
PspPI GGNCC 1 cut(s) 220
PspPPI RGGWCCY 1 cut(s) 220
PsuI RGATCY 1 cut(s) 142
PvuII CAGCTG 1 cut(s) 260
RsaI GTAC 1 cut(s) 276
RsaNI GTAC 1 cut(s) 275
SaqAI TTAA 1 cut(s) 168
SatI GCNGC 2 cut(s) 89, 291
Sau3AI GATC 2 cut(s) 142, 254
Sau96I GGNCC 1 cut(s) 220
ScaI AGTACT 1 cut(s) 276
SduI GDGCHC 1 cut(s) 210
SetI ASST 8 cut(s) 16, 45, 55, 69, 174, 225, 262, 321
SinI GGWCC 1 cut(s) 220
Sse9I AATT 1 cut(s) 116
SsiI CCGC 2 cut(s) 37, 88
TaaI ACNGT 2 cut(s) 138, 203
TaiI ACGT 1 cut(s) 69
TaqII GACCGA 1 cut(s) 267
TasI AATT 1 cut(s) 116
TatI WGTACW 1 cut(s) 274
TauI GCSGC 1 cut(s) 91
Tru1I TTAA 1 cut(s) 168
Tru9I TTAA 1 cut(s) 168
TscAI CASTG 1 cut(s) 208
TseI GCWGC 1 cut(s) 290
TspDTI ATGAA 1 cut(s) 281
TspRI CASTG 1 cut(s) 208
VneI GTGCAC 1 cut(s) 206
VpaK11BI GGWCC 1 cut(s) 220
XapI RAATTY 1 cut(s) 116
ZrmI AGTACT 1 cut(s) 276
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.