Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000202.1

Orthogroup ID

OG0021549

Physical Location & Seq

Genomic Coordinates Forward (+)

116740 .. 117096

Gene Structure 357 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 357 bp

atgaaacaactacacaagcaatcgagcctcctctttatccttgttgtcattctcatcggctccaccttctttatcctccagcccactctctcctgtctctccccttctgagcccaatccctccatcccccgatccttctcctccgtccacgaccgaattaacaccacttccttctccaccgacctccgcaacaatgccgacaaggttcccgtcggcctcggcaaggcatgtgattatctgaataagaagaagaagaaaaagaacctggtcaagttccagaagacttgggtcgaggcgtcgaagaggcttgaaagaaggctaagggcggtcgggtcggtgaatttggaccatagctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000166 GO:0003674 GO:0003824 GO:0005488 GO:0005975 GO:0005996 GO:0008150 GO:0008152 GO:0016829 GO:0016830 GO:0016831 GO:0019321 GO:0036094 GO:0042732 GO:0043167 GO:0043168 GO:0044238 GO:0044281 GO:0048037 GO:0048040 GO:0050662 GO:0051287 GO:0070403 GO:0071704 GO:0097159 GO:1901265 GO:1901363

KEGG Pathways

Metabolic & Signaling

ko00520 ko01100 map00520 map01100

Pfam Domains

Protein Families

GDP_Man_Dehyd

Protein Analysis

118

Amino Acids

13.31

Weight (kDa)

10.25

Isoelectric Point (pI)

65.14

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021549)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000013374
rosa_multiflora	Rmu_sc0000202.1_g000030 Rmu_sc0006139.1_g000003
rosa_samantha	Rh1BG394400 Rh6DG250700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	187, 326
AclWI	GGATC	1 cut(s)	126
AcsI	RAATTY	1 cut(s)	340
AcyI	GRCGYC	1 cut(s)	296
AfiI	CCNNNNNNNGG	1 cut(s)	223
AgsI	TTSAA	1 cut(s)	311
AjnI	CCWGG	1 cut(s)	264
AluBI	AGCT	1 cut(s)	354
AluI	AGCT	1 cut(s)	354
Alw26I	GTCTC	1 cut(s)	101
AlwI	GGATC	1 cut(s)	126
AoxI	GGCC	1 cut(s)	214
ApoI	RAATTY	1 cut(s)	340
AspS9I	GGNCC	1 cut(s)	346
AsuHPI	GGTGA	1 cut(s)	349
AvaII	GGWCC	1 cut(s)	346
BanII	GRGCYC	1 cut(s)	114
BbsI	GAAGAC	1 cut(s)	287
BccI	CCATC	1 cut(s)	131
BciT130I	CCWGG	1 cut(s)	266
BcoDI	GTCTC	1 cut(s)	101
BfaI	CTAG	1 cut(s)	355
Bme1390I	CCNGG	1 cut(s)	266
Bme18I	GGWCC	1 cut(s)	346
BmgT120I	GGNCC	1 cut(s)	346
BmiI	GGNNCC	2 cut(s)	61, 207
BmrFI	CCNGG	1 cut(s)	266
BoxI	GACNNNNGTC	1 cut(s)	287
BpiI	GAAGAC	1 cut(s)	287
BpmI	CTGGAG	1 cut(s)	62
Bpu10I	CCTNAGC	1 cut(s)	320
BsaHI	GRCGYC	1 cut(s)	296
BsaJI	CCNNGG	1 cut(s)	217
Bsc4I	CCNNNNNNNGG	1 cut(s)	223
BseBI	CCWGG	1 cut(s)	266
BseDI	CCNNGG	1 cut(s)	217
BseGI	GGATG	1 cut(s)	123
BseLI	CCNNNNNNNGG	1 cut(s)	223
BseMII	CTCAG	1 cut(s)	99
BseRI	GAGGAG	2 cut(s)	20, 130
Bsh1285I	CGRYCG	2 cut(s)	154, 330
BshFI	GGCC	1 cut(s)	216
BsiEI	CGRYCG	2 cut(s)	154, 330
BslI	CCNNNNNNNGG	1 cut(s)	223
BsmAI	GTCTC	1 cut(s)	101
BsnI	GGCC	1 cut(s)	216
Bsp1286I	GDGCHC	1 cut(s)	114
Bsp143I	GATC	1 cut(s)	131
BspACI	CCGC	2 cut(s)	187, 326
BspANI	GGCC	1 cut(s)	216
BspCNI	CTCAG	1 cut(s)	100
BspLI	GGNNCC	2 cut(s)	61, 207
BspPI	GGATC	1 cut(s)	126
BssECI	CCNNGG	1 cut(s)	217
BssMI	GATC	1 cut(s)	131
BssNI	GRCGYC	1 cut(s)	296
Bst2UI	CCWGG	1 cut(s)	266
Bst6I	CTCTTC	1 cut(s)	296
BstACI	GRCGYC	1 cut(s)	296
BstDEI	CTNAG	2 cut(s)	108, 320
BstENI	CCTNNNNNAGG	1 cut(s)	221
BstF5I	GGATG	1 cut(s)	123
BstKTI	GATC	1 cut(s)	134
BstMAI	GTCTC	1 cut(s)	101
BstMBI	GATC	1 cut(s)	131
BstMCI	CGRYCG	2 cut(s)	154, 330
BstNI	CCWGG	1 cut(s)	266
BstNSI	RCATGY	1 cut(s)	231
BstPAI	GACNNNNGTC	1 cut(s)	287
BstSCI	CCNGG	1 cut(s)	264
BstV2I	GAAGAC	1 cut(s)	287
BsuRI	GGCC	1 cut(s)	216
BtsCI	GGATG	1 cut(s)	123
Cfr13I	GGNCC	1 cut(s)	346
CseI	GACGC	1 cut(s)	285
CsiI	ACCWGGT	1 cut(s)	264
CviAII	CATG	1 cut(s)	228
CviJI	RGCY	8 cut(s)	27, 60, 82, 112, 216, 307, 319, 354
CviKI_1	RGCY	8 cut(s)	27, 60, 82, 112, 216, 307, 319, 354
DdeI	CTNAG	2 cut(s)	108, 320
DpnI	GATC	1 cut(s)	133
DpnII	GATC	1 cut(s)	131
Eam1104I	CTCTTC	1 cut(s)	296
EarI	CTCTTC	1 cut(s)	296
Eco24I	GRGCYC	1 cut(s)	114
Eco47I	GGWCC	1 cut(s)	346
EcoNI	CCTNNNNNAGG	1 cut(s)	221
EcoRII	CCWGG	1 cut(s)	264
EcoT38I	GRGCYC	1 cut(s)	114
FaeI	CATG	1 cut(s)	231
FaiI	YATR	2 cut(s)	229, 351
FatI	CATG	1 cut(s)	227
FokI	GGATG	1 cut(s)	110
FriOI	GRGCYC	1 cut(s)	114
FspBI	CTAG	1 cut(s)	355
GsuI	CTGGAG	1 cut(s)	62
HaeIII	GGCC	1 cut(s)	216
HgaI	GACGC	1 cut(s)	285
Hin1I	GRCGYC	1 cut(s)	296
Hin1II	CATG	1 cut(s)	231
HphI	GGTGA	1 cut(s)	349
Hpy166II	GTNNAC	1 cut(s)	148
Hpy188I	TCNGA	2 cut(s)	109, 240
Hpy188III	TCNNGA	1 cut(s)	277
Hpy8I	GTNNAC	1 cut(s)	148
Hpy99I	CGWCG	2 cut(s)	215, 301
HpyAV	CCTTC	5 cut(s)	76, 114, 145, 181, 309
HpyF3I	CTNAG	2 cut(s)	108, 320
Hsp92I	GRCGYC	1 cut(s)	296
Hsp92II	CATG	1 cut(s)	231
Kzo9I	GATC	1 cut(s)	131
LmnI	GCTCC	1 cut(s)	65
LpnPI	CCDG	5 cut(s)	92, 106, 251, 278, 290
MabI	ACCWGGT	1 cut(s)	264
MaeI	CTAG	1 cut(s)	355
MalI	GATC	1 cut(s)	133
MboI	GATC	1 cut(s)	131
MboII	GAAGA	5 cut(s)	259, 262, 265, 292, 313
MhlI	GDGCHC	1 cut(s)	114
MluCI	AATT	2 cut(s)	156, 340
MnlI	CCTC	9 cut(s)	38, 41, 86, 130, 151, 194, 227, 286, 297
MseI	TTAA	1 cut(s)	159
MspR9I	CCNGG	1 cut(s)	266
MvaI	CCWGG	1 cut(s)	266
NdeII	GATC	1 cut(s)	131
NlaIII	CATG	1 cut(s)	231
NlaIV	GGNNCC	2 cut(s)	61, 207
NmeAIII	GCCGAG	1 cut(s)	198
NspI	RCATGY	1 cut(s)	231
PshAI	GACNNNNGTC	1 cut(s)	287
Psp6I	CCWGG	1 cut(s)	264
PspGI	CCWGG	1 cut(s)	264
PspN4I	GGNNCC	2 cut(s)	61, 207
PspPI	GGNCC	1 cut(s)	346
SaqAI	TTAA	1 cut(s)	159
Sau3AI	GATC	1 cut(s)	131
Sau96I	GGNCC	1 cut(s)	346
ScrFI	CCNGG	1 cut(s)	266
SduI	GDGCHC	1 cut(s)	114
SetI	ASST	5 cut(s)	68, 186, 207, 267, 356
SexAI	ACCWGGT	1 cut(s)	264
SinI	GGWCC	1 cut(s)	346
Sse9I	AATT	2 cut(s)	156, 340
SsiI	CCGC	2 cut(s)	187, 326
SspMI	CTAG	1 cut(s)	355
StyD4I	CCNGG	1 cut(s)	264
TaqI	TCGA	3 cut(s)	23, 291, 299
TaqII	GACCGA	1 cut(s)	168
TasI	AATT	2 cut(s)	156, 340
Tru1I	TTAA	1 cut(s)	159
Tru9I	TTAA	1 cut(s)	159
TspDTI	ATGAA	1 cut(s)	17
TspGWI	ACGGA	1 cut(s)	133
VpaK11BI	GGWCC	1 cut(s)	346
XagI	CCTNNNNNAGG	1 cut(s)	221
XapI	RAATTY	1 cut(s)	340
XceI	RCATGY	1 cut(s)	231
XspI	CTAG	1 cut(s)	355

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.