Rmu_sc0000355.1_g000026

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000355.1
OG0023037
Physical Location & Seq
Reverse (-)
158914 .. 159369
456 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000355.1_g000026.1.cds

Sequence Viewer

Length: 456 bp
atggtgggagatttcaatgaaatcttctgtcaagctgataaatctagaggcgtacctagggctcctgctcctatggctgcgttcaggcaaacgatgaatgattgtggtctacatgacataagatttattggtagcagatatacttggtccaataagttcacgaaggaacaacttgactttccttatggtcgaactatgacacttccacctagcgaatccgatcactatcctttgcttgttgaactaaggactaatggttgtctattccaaaaaccagtgaggcgttttaggtttggggaatgtggcatggaaatgatgaatgcaccaatatcattcagcgacaatggttctctcccatcactggaaacatgcttcagcaagttagtcgaaagatttctgcaacaagcaaacatttgcttaaatggcatgtcattgaatttcagaaacaaaaggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Exo_endo_phos

Protein Analysis

151

Amino Acids

17.33

Weight (kDa)

8.83

Isoelectric Point (pI)

50.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023037)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000355.1_g000026 Rmu_sc0004574.1_g000006 Rmu_sc0008676.1_g000025 Rmu_sc0021503.1_g000003

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 109
AcsI RAATTY 1 cut(s) 436
AcuI CTGAAG 1 cut(s) 358
AfaI GTAC 1 cut(s) 54
AfiI CCNNNNNNNGG 1 cut(s) 361
AgsI TTSAA 3 cut(s) 16, 242, 436
AluBI AGCT 1 cut(s) 35
AluI AGCT 1 cut(s) 35
ApeKI GCWGC 1 cut(s) 77
ApoI RAATTY 1 cut(s) 436
Asp700I GAANNNNTTC 1 cut(s) 393
AspA2I CCTAGG 1 cut(s) 56
AspS9I GGNCC 1 cut(s) 147
AvaII GGWCC 1 cut(s) 147
AvrII CCTAGG 1 cut(s) 56
BanII GRGCYC 1 cut(s) 64
BbvI GCAGC 1 cut(s) 64
BccI CCATC 1 cut(s) 364
BcgI CGANNNNNNTGC 2 cut(s) 367, 401
BfaI CTAG 3 cut(s) 45, 57, 210
BisI GCNGC 1 cut(s) 78
BlnI CCTAGG 1 cut(s) 56
BlsI GCNGC 1 cut(s) 79
Bme18I GGWCC 1 cut(s) 147
BmgT120I GGNCC 1 cut(s) 147
BmiI GGNNCC 1 cut(s) 63
BsaBI GATNNNNATC 1 cut(s) 225
BsaJI CCNNGG 1 cut(s) 56
Bsc4I CCNNNNNNNGG 1 cut(s) 361
Bse1I ACTGG 2 cut(s) 275, 366
Bse8I GATNNNNATC 1 cut(s) 225
BseDI CCNNGG 1 cut(s) 56
BseJI GATNNNNATC 1 cut(s) 225
BseLI CCNNNNNNNGG 1 cut(s) 361
BseNI ACTGG 2 cut(s) 275, 366
BseXI GCAGC 1 cut(s) 64
BslI CCNNNNNNNGG 1 cut(s) 361
BsmI GAATGC 1 cut(s) 325
Bsp1286I GDGCHC 1 cut(s) 64
Bsp143I GATC 1 cut(s) 220
BspLI GGNNCC 1 cut(s) 63
BsrI ACTGG 2 cut(s) 275, 366
BssECI CCNNGG 1 cut(s) 56
BssMI GATC 1 cut(s) 220
BssT1I CCWWGG 1 cut(s) 56
BstDEI CTNAG 1 cut(s) 245
BstKTI GATC 1 cut(s) 223
BstMBI GATC 1 cut(s) 220
BstMWI GCNNNNNNNGC 2 cut(s) 74, 423
BstNSI RCATGY 2 cut(s) 372, 430
BstV1I GCAGC 1 cut(s) 64
BtsIMutI CAGTG 2 cut(s) 282, 359
Cfr13I GGNCC 1 cut(s) 147
Csp6I GTAC 1 cut(s) 53
CviAII CATG 4 cut(s) 113, 307, 369, 427
CviJI RGCY 3 cut(s) 35, 62, 77
CviKI_1 RGCY 3 cut(s) 35, 62, 77
CviQI GTAC 1 cut(s) 53
DdeI CTNAG 1 cut(s) 245
DpnI GATC 1 cut(s) 222
DpnII GATC 1 cut(s) 220
Eco130I CCWWGG 1 cut(s) 56
Eco24I GRGCYC 1 cut(s) 64
Eco47I GGWCC 1 cut(s) 147
Eco57I CTGAAG 1 cut(s) 358
EcoT14I CCWWGG 1 cut(s) 56
EcoT38I GRGCYC 1 cut(s) 64
ErhI CCWWGG 1 cut(s) 56
FaeI CATG 4 cut(s) 116, 310, 372, 430
FaiI YATR 9 cut(s) 74, 114, 119, 141, 186, 197, 308, 370, 428
FatI CATG 4 cut(s) 112, 306, 368, 426
FblI GTMKAC 1 cut(s) 109
Fnu4HI GCNGC 1 cut(s) 78
FriOI GRGCYC 1 cut(s) 64
Fsp4HI GCNGC 1 cut(s) 78
FspBI CTAG 3 cut(s) 45, 57, 210
GluI GCNGC 1 cut(s) 78
Hin1II CATG 4 cut(s) 116, 310, 372, 430
HinfI GANTC 1 cut(s) 215
Hpy166II GTNNAC 2 cut(s) 110, 159
Hpy188I TCNGA 2 cut(s) 220, 443
Hpy188III TCNNGA 2 cut(s) 45, 160
Hpy8I GTNNAC 2 cut(s) 110, 159
HpyAV CCTTC 1 cut(s) 157
HpyCH4V TGCA 2 cut(s) 323, 400
HpyF10VI GCNNNNNNNGC 2 cut(s) 74, 423
HpyF3I CTNAG 1 cut(s) 245
Hsp92II CATG 4 cut(s) 116, 310, 372, 430
Kzo9I GATC 1 cut(s) 220
LmnI GCTCC 2 cut(s) 67, 73
LpnPI CCDG 4 cut(s) 70, 78, 288, 347
Lsp1109I GCAGC 1 cut(s) 64
MaeI CTAG 3 cut(s) 45, 57, 210
MalI GATC 1 cut(s) 222
MboI GATC 1 cut(s) 220
MboII GAAGA 1 cut(s) 16
MhlI GDGCHC 1 cut(s) 64
MluCI AATT 1 cut(s) 436
MnlI CCTC 2 cut(s) 41, 273
MroXI GAANNNNTTC 1 cut(s) 393
MseI TTAA 1 cut(s) 419
MslI CAYNNNNRTG 1 cut(s) 311
Mva1269I GAATGC 1 cut(s) 325
MwoI GCNNNNNNNGC 2 cut(s) 74, 423
NdeII GATC 1 cut(s) 220
NlaIII CATG 4 cut(s) 116, 310, 372, 430
NlaIV GGNNCC 1 cut(s) 63
NspI RCATGY 2 cut(s) 372, 430
PctI GAATGC 1 cut(s) 325
PdmI GAANNNNTTC 1 cut(s) 393
PfeI GAWTC 1 cut(s) 215
PkrI GCNGC 1 cut(s) 79
PspN4I GGNNCC 1 cut(s) 63
PspPI GGNCC 1 cut(s) 147
RsaI GTAC 1 cut(s) 54
RsaNI GTAC 1 cut(s) 53
RseI CAYNNNNRTG 1 cut(s) 311
SaqAI TTAA 1 cut(s) 419
SatI GCNGC 1 cut(s) 78
Sau3AI GATC 1 cut(s) 220
Sau96I GGNCC 1 cut(s) 147
SduI GDGCHC 1 cut(s) 64
SetI ASST 5 cut(s) 37, 58, 211, 293, 455
SinI GGWCC 1 cut(s) 147
SmiMI CAYNNNNRTG 1 cut(s) 311
Sse9I AATT 1 cut(s) 436
SspMI CTAG 3 cut(s) 45, 57, 210
StyI CCWWGG 1 cut(s) 56
TaqI TCGA 2 cut(s) 190, 387
TasI AATT 1 cut(s) 436
TfiI GAWTC 1 cut(s) 215
Tru1I TTAA 1 cut(s) 419
Tru9I TTAA 1 cut(s) 419
TscAI CASTG 2 cut(s) 282, 366
TseI GCWGC 1 cut(s) 77
TspDTI ATGAA 3 cut(s) 33, 110, 332
TspRI CASTG 2 cut(s) 282, 366
VpaK11BI GGWCC 1 cut(s) 147
XapI RAATTY 1 cut(s) 436
XbaI TCTAGA 1 cut(s) 44
XceI RCATGY 2 cut(s) 372, 430
XmaJI CCTAGG 1 cut(s) 56
XmiI GTMKAC 1 cut(s) 109
XmnI GAANNNNTTC 1 cut(s) 393
XspI CTAG 3 cut(s) 45, 57, 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.