Rmu_sc0004574.1_g000006

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004574.1
OG0023037
Physical Location & Seq
Forward (+)
22196 .. 23098
903 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004574.1_g000006.1.cds

Sequence Viewer

Length: 756 bp
atgctacagggaaacattttgatctggaattgcacaggcatagtcctcaatgagacacaacaagcccttattgacttgagcaatgggattcatgttgatctgcgcacaaaatctcctcatcacattgaggttgaggtttgcgaacaaggaagccatgcttcttaccgtttcactggaatttatggcttcgctgcacggggagaacgcaatagaacatgggatttaattcgaaccctagcggctgaaagatgtgatctggcttggctcatggcaggtgattttaatgaaatcatgtgccaggctgacaagtccggcggagtaccacgagctgttgcacccatggcttcatttagacatacgatggtggattgtggcctcgttgatatgggattcagtggcagtaggtatacttggtccaataagtttaccaaagaacgtcttgacagaagttttcaatcaattcaatggagggattcttacccttacagtaggacaatcacctgccaccaaatgagtctgatcattaccccatccttgttgaactgcgatctgagcaacatcatttcaggaaagctagcaggagatttaggtttgaagaaatgtggcatggcaatgaacaatgcaatgccatcattcaaaagaactggtctgcccctacaaccggcaacatgctgcatcaaattggacagaaaatttctaacacaggtacacaactcttgcgctggcataccacaaaatttgagaagcaaaaggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_3

Protein Analysis

251

Amino Acids

28.1

Weight (kDa)

9.0

Isoelectric Point (pI)

42.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023037)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000355.1_g000026 Rmu_sc0004574.1_g000006 Rmu_sc0008676.1_g000025 Rmu_sc0021503.1_g000003

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 2 cut(s) 263, 509
Acc16I TGCGCA 1 cut(s) 104
Acc36I ACCTGC 2 cut(s) 263, 509
AccI GTMKAC 1 cut(s) 407
AciI CCGC 2 cut(s) 239, 315
AcsI RAATTY 3 cut(s) 177, 692, 736
AfaI GTAC 2 cut(s) 321, 708
AfiI CCNNNNNNNGG 1 cut(s) 661
AgsI TTSAA 5 cut(s) 455, 464, 541, 595, 637
AjnI CCWGG 1 cut(s) 297
AluBI AGCT 2 cut(s) 329, 574
AluI AGCT 2 cut(s) 329, 574
Alw26I GTCTC 1 cut(s) 47
AoxI GGCC 1 cut(s) 373
ApeKI GCWGC 2 cut(s) 191, 672
ApoI RAATTY 3 cut(s) 177, 692, 736
AspLEI GCGC 2 cut(s) 105, 722
AspS9I GGNCC 1 cut(s) 414
AsuHPI GGTGA 2 cut(s) 287, 490
AsuII TTCGAA 1 cut(s) 229
AsuNHI GCTAGC 1 cut(s) 574
AvaII GGWCC 1 cut(s) 414
BauI CACGAG 1 cut(s) 324
BbvI GCAGC 2 cut(s) 178, 659
BccI CCATC 3 cut(s) 355, 538, 637
BciT130I CCWGG 1 cut(s) 299
BclI TGATCA 1 cut(s) 519
BcoDI GTCTC 1 cut(s) 47
BfaI CTAG 2 cut(s) 236, 575
BfmI CTRYAG 1 cut(s) 5
BfuAI ACCTGC 2 cut(s) 263, 509
BisI GCNGC 3 cut(s) 192, 240, 673
BlsI GCNGC 3 cut(s) 193, 241, 674
Bme1390I CCNGG 1 cut(s) 299
Bme18I GGWCC 1 cut(s) 414
BmgT120I GGNCC 1 cut(s) 414
BmrFI CCNGG 1 cut(s) 299
BmsI GCATC 1 cut(s) 684
BmtI GCTAGC 1 cut(s) 578
Bpu14I TTCGAA 1 cut(s) 229
BpuEI CTTGAG 1 cut(s) 97
BsaJI CCNNGG 1 cut(s) 339
BsaXI ACNNNNNCTCC 2 cut(s) 97, 127
Bsc4I CCNNNNNNNGG 1 cut(s) 661
Bse118I RCCGGY 1 cut(s) 661
Bse1I ACTGG 2 cut(s) 178, 649
Bse3DI GCAATG 3 cut(s) 88, 618, 630
BseBI CCWGG 1 cut(s) 299
BseDI CCNNGG 1 cut(s) 339
BseGI GGATG 1 cut(s) 530
BseLI CCNNNNNNNGG 1 cut(s) 661
BseMI GCAATG 3 cut(s) 88, 618, 630
BseMII CTCAG 1 cut(s) 542
BseNI ACTGG 2 cut(s) 178, 649
BseRI GAGGAG 1 cut(s) 105
BseXI GCAGC 2 cut(s) 178, 659
BsgI GTGCAG 1 cut(s) 177
BshFI GGCC 1 cut(s) 375
BsiSI CCGG 2 cut(s) 312, 662
BslI CCNNNNNNNGG 1 cut(s) 661
BsmAI GTCTC 1 cut(s) 47
BsnI GGCC 1 cut(s) 375
Bsp119I TTCGAA 1 cut(s) 229
Bsp143I GATC 5 cut(s) 21, 97, 253, 519, 547
Bsp19I CCATGG 1 cut(s) 339
BspACI CCGC 2 cut(s) 239, 315
BspANI GGCC 1 cut(s) 375
BspCNI CTCAG 1 cut(s) 543
BspMI ACCTGC 2 cut(s) 263, 509
BspOI GCTAGC 1 cut(s) 578
BspT104I TTCGAA 1 cut(s) 229
BsrDI GCAATG 3 cut(s) 88, 618, 630
BsrFI RCCGGY 1 cut(s) 661
BsrI ACTGG 2 cut(s) 178, 649
BssAI RCCGGY 1 cut(s) 661
BssECI CCNNGG 1 cut(s) 339
BssMI GATC 5 cut(s) 21, 97, 253, 519, 547
BssNAI GTATAC 1 cut(s) 408
BssSI CACGAG 1 cut(s) 324
BssT1I CCWWGG 1 cut(s) 339
Bst1107I GTATAC 1 cut(s) 408
Bst2BI CACGAG 1 cut(s) 324
Bst2UI CCWGG 1 cut(s) 299
Bst4CI ACNGT 2 cut(s) 167, 488
BstBI TTCGAA 1 cut(s) 229
BstC8I GCNNGC 2 cut(s) 576, 724
BstDEI CTNAG 1 cut(s) 551
BstDSI CCRYGG 1 cut(s) 339
BstF5I GGATG 1 cut(s) 530
BstHHI GCGC 2 cut(s) 105, 722
BstKTI GATC 5 cut(s) 24, 100, 256, 522, 550
BstMAI GTCTC 1 cut(s) 47
BstMBI GATC 5 cut(s) 21, 97, 253, 519, 547
BstMWI GCNNNNNNNGC 2 cut(s) 341, 552
BstNI CCWGG 1 cut(s) 299
BstNSI RCATGY 1 cut(s) 672
BstSCI CCNGG 1 cut(s) 297
BstSFI CTRYAG 1 cut(s) 5
BstV1I GCAGC 2 cut(s) 178, 659
BstZ17I GTATAC 1 cut(s) 408
BsuRI GGCC 1 cut(s) 375
BtgI CCRYGG 1 cut(s) 339
BtsCI GGATG 1 cut(s) 530
BtsIMutI CAGTG 2 cut(s) 171, 400
BveI ACCTGC 2 cut(s) 263, 509
Cac8I GCNNGC 2 cut(s) 576, 724
CfoI GCGC 2 cut(s) 105, 722
Cfr10I RCCGGY 1 cut(s) 661
Cfr13I GGNCC 1 cut(s) 414
Csp6I GTAC 2 cut(s) 320, 707
CspCI CAANNNNNGTGG 2 cut(s) 720, 755
CviAII CATG 8 cut(s) 92, 155, 216, 268, 292, 340, 607, 669
CviQI GTAC 2 cut(s) 320, 707
DdeI CTNAG 1 cut(s) 551
DpnI GATC 5 cut(s) 23, 99, 255, 521, 549
DpnII GATC 5 cut(s) 21, 97, 253, 519, 547
EciI GGCGGA 1 cut(s) 330
Eco130I CCWWGG 1 cut(s) 339
Eco47I GGWCC 1 cut(s) 414
EcoRII CCWGG 1 cut(s) 297
EcoT14I CCWWGG 1 cut(s) 339
ErhI CCWWGG 1 cut(s) 339
FaeI CATG 8 cut(s) 95, 158, 219, 271, 295, 343, 610, 672
FalI AAGNNNNNCTT 4 cut(s) 142, 174, 423, 455
FatI CATG 8 cut(s) 91, 154, 215, 267, 291, 339, 606, 668
FbaI TGATCA 1 cut(s) 519
FblI GTMKAC 1 cut(s) 407
Fnu4HI GCNGC 3 cut(s) 192, 240, 673
FokI GGATG 1 cut(s) 517
Fsp4HI GCNGC 3 cut(s) 192, 240, 673
FspBI CTAG 2 cut(s) 236, 575
FspI TGCGCA 1 cut(s) 104
GlaI GCGC 2 cut(s) 104, 721
GluI GCNGC 3 cut(s) 192, 240, 673
HaeIII GGCC 1 cut(s) 375
HapII CCGG 2 cut(s) 312, 662
HhaI GCGC 2 cut(s) 105, 722
Hin1II CATG 8 cut(s) 95, 158, 219, 271, 295, 343, 610, 672
Hin6I GCGC 2 cut(s) 103, 720
HinP1I GCGC 2 cut(s) 103, 720
HinfI GANTC 4 cut(s) 88, 390, 473, 514
HpaII CCGG 2 cut(s) 312, 662
HphI GGTGA 2 cut(s) 287, 490
Hpy166II GTNNAC 3 cut(s) 408, 426, 709
Hpy188I TCNGA 2 cut(s) 519, 552
Hpy188III TCNNGA 3 cut(s) 25, 440, 567
Hpy8I GTNNAC 3 cut(s) 408, 426, 709
HpyCH4III ACNGT 2 cut(s) 167, 488
HpyCH4IV ACGT 1 cut(s) 436
HpyCH4V TGCA 5 cut(s) 33, 194, 335, 623, 675
HpyF10VI GCNNNNNNNGC 2 cut(s) 341, 552
HpyF3I CTNAG 1 cut(s) 551
HpySE526I ACGT 1 cut(s) 436
Hsp92II CATG 8 cut(s) 95, 158, 219, 271, 295, 343, 610, 672
HspAI GCGC 2 cut(s) 103, 720
Ksp22I TGATCA 1 cut(s) 519
Kzo9I GATC 5 cut(s) 21, 97, 253, 519, 547
Lsp1109I GCAGC 2 cut(s) 178, 659
LweI GCATC 1 cut(s) 684
MaeI CTAG 2 cut(s) 236, 575
MaeII ACGT 1 cut(s) 436
MalI GATC 5 cut(s) 23, 99, 255, 521, 549
MboI GATC 5 cut(s) 21, 97, 253, 519, 547
MboII GAAGA 1 cut(s) 607
MluCI AATT 7 cut(s) 28, 177, 225, 459, 680, 692, 736
MlyI GAGTC 1 cut(s) 523
MnlI CCTC 6 cut(s) 56, 121, 126, 127, 386, 462
MseI TTAA 2 cut(s) 224, 282
MslI CAYNNNNRTG 1 cut(s) 611
MspI CCGG 2 cut(s) 312, 662
MspR9I CCNGG 1 cut(s) 299
MvaI CCWGG 1 cut(s) 299
MwoI GCNNNNNNNGC 2 cut(s) 341, 552
NcoI CCATGG 1 cut(s) 339
NdeII GATC 5 cut(s) 21, 97, 253, 519, 547
NheI GCTAGC 1 cut(s) 574
NlaIII CATG 8 cut(s) 95, 158, 219, 271, 295, 343, 610, 672
NsbI TGCGCA 1 cut(s) 104
NspI RCATGY 1 cut(s) 672
NspV TTCGAA 1 cut(s) 229
PaqCI CACCTGC 2 cut(s) 263, 509
PfeI GAWTC 3 cut(s) 88, 390, 473
PkrI GCNGC 3 cut(s) 193, 241, 674
PleI GAGTC 1 cut(s) 522
PpsI GAGTC 1 cut(s) 522
Psp6I CCWGG 1 cut(s) 297
PspGI CCWGG 1 cut(s) 297
PspPI GGNCC 1 cut(s) 414
RsaI GTAC 2 cut(s) 321, 708
RsaNI GTAC 2 cut(s) 320, 707
RseI CAYNNNNRTG 1 cut(s) 611
SaqAI TTAA 2 cut(s) 224, 282
SatI GCNGC 3 cut(s) 192, 240, 673
Sau3AI GATC 5 cut(s) 21, 97, 253, 519, 547
Sau96I GGNCC 1 cut(s) 414
SchI GAGTC 1 cut(s) 523
ScrFI CCNGG 1 cut(s) 299
SfaNI GCATC 1 cut(s) 684
SfcI CTRYAG 1 cut(s) 5
SfuI TTCGAA 1 cut(s) 229
SinI GGWCC 1 cut(s) 414
SmiMI CAYNNNNRTG 1 cut(s) 611
SmlI CTYRAG 1 cut(s) 76
SmoI CTYRAG 1 cut(s) 76
Sse9I AATT 7 cut(s) 28, 177, 225, 459, 680, 692, 736
SsiI CCGC 2 cut(s) 239, 315
SspMI CTAG 2 cut(s) 236, 575
StyD4I CCNGG 1 cut(s) 297
StyI CCWWGG 1 cut(s) 339
TaaI ACNGT 2 cut(s) 167, 488
TaiI ACGT 1 cut(s) 439
TaqI TCGA 1 cut(s) 229
TasI AATT 7 cut(s) 28, 177, 225, 459, 680, 692, 736
TauI GCSGC 1 cut(s) 242
TfiI GAWTC 3 cut(s) 88, 390, 473
Tru1I TTAA 2 cut(s) 224, 282
Tru9I TTAA 2 cut(s) 224, 282
TscAI CASTG 2 cut(s) 178, 400
TseI GCWGC 2 cut(s) 191, 672
TspDTI ATGAA 4 cut(s) 80, 300, 336, 629
TspRI CASTG 2 cut(s) 178, 400
VpaK11BI GGWCC 1 cut(s) 414
XapI RAATTY 3 cut(s) 177, 692, 736
XceI RCATGY 1 cut(s) 672
XmiI GTMKAC 1 cut(s) 407
XspI CTAG 2 cut(s) 236, 575
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.