Rmu_sc0000435.1_g000054

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000435.1
OG0021442
Physical Location & Seq
Reverse (-)
248229 .. 249060
832 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000435.1_g000054.1.cds

Sequence Viewer

Length: 393 bp
atgagagccaggaaagagcttgaaaaggcagagcggagagccaccgcacagttaatgttcgacttgggacagaaggcttatgggagggggatgtacggttgtgcctttgagttcctagaacgagcactgacaatcattccgaggccaacgttatttggtgctgagattcaaatttggcttgtcatggcctatgaggcaaataagcgctatgccaattgcattgatctttataagcaattggagaacaagcacccaagtgtcagcttcccacaccaggctgcagagttcgctacattttccaagcaccgaagatcaagattaaagattactcgagaagagatggtaactataccactcatcaagccattttatgttcagctagacgagggctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

130

Amino Acids

15.2

Weight (kDa)

9.48

Isoelectric Point (pI)

42.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021442)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0067811
rosa_multiflora Rmu_sc0000435.1_g000054
rosa_samantha Rh5CG484400 Rh5DG476600
rosa_wichuraiana Rw5G041570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 231
AccBSI CCGCTC 1 cut(s) 34
AciI CCGC 2 cut(s) 34, 45
AclI AACGTT 1 cut(s) 149
AcsI RAATTY 1 cut(s) 171
AfaI GTAC 1 cut(s) 95
AfeI AGCGCT 1 cut(s) 206
AfiI CCNNNNNNNGG 1 cut(s) 274
AgsI TTSAA 2 cut(s) 23, 170
AjnI CCWGG 2 cut(s) 8, 273
AleI CACNNNNGTG 1 cut(s) 255
AluBI AGCT 3 cut(s) 19, 264, 379
AluI AGCT 3 cut(s) 19, 264, 379
Alw21I GWGCWC 1 cut(s) 127
Ama87I CYCGRG 1 cut(s) 330
Aor51HI AGCGCT 1 cut(s) 206
AoxI GGCC 2 cut(s) 143, 186
ApeKI GCWGC 1 cut(s) 278
ApoI RAATTY 1 cut(s) 171
AspLEI GCGC 1 cut(s) 207
AvaI CYCGRG 1 cut(s) 330
Bbv12I GWGCWC 1 cut(s) 127
BbvI GCAGC 1 cut(s) 265
BccI CCATC 1 cut(s) 334
BciT130I CCWGG 2 cut(s) 10, 275
BfaI CTAG 2 cut(s) 116, 380
BfmI CTRYAG 1 cut(s) 279
BfoI RGCGCY 1 cut(s) 208
BglI GCCNNNNNGGC 1 cut(s) 194
BisI GCNGC 1 cut(s) 279
BlsI GCNGC 1 cut(s) 280
Bme1390I CCNGG 2 cut(s) 10, 275
BmeT110I CYCGRG 1 cut(s) 330
BmrFI CCNGG 2 cut(s) 10, 275
BsaJI CCNNGG 1 cut(s) 140
Bsc4I CCNNNNNNNGG 1 cut(s) 274
BseBI CCWGG 2 cut(s) 10, 275
BseDI CCNNGG 1 cut(s) 140
BseGI GGATG 1 cut(s) 96
BseLI CCNNNNNNNGG 1 cut(s) 274
BseMII CTCAG 1 cut(s) 153
BseXI GCAGC 1 cut(s) 265
BshFI GGCC 2 cut(s) 145, 188
BsiHKAI GWGCWC 1 cut(s) 127
BsiHKCI CYCGRG 1 cut(s) 330
BslFI GGGAC 1 cut(s) 81
BslI CCNNNNNNNGG 1 cut(s) 274
BsmFI GGGAC 1 cut(s) 81
BsnI GGCC 2 cut(s) 145, 188
BsoBI CYCGRG 1 cut(s) 330
Bsp1286I GDGCHC 1 cut(s) 127
Bsp143I GATC 2 cut(s) 223, 311
BspACI CCGC 2 cut(s) 34, 45
BspANI GGCC 2 cut(s) 145, 188
BspCNI CTCAG 1 cut(s) 154
BspMAI CTGCAG 1 cut(s) 283
BsrBI CCGCTC 1 cut(s) 34
BssECI CCNNGG 1 cut(s) 140
BssMI GATC 2 cut(s) 223, 311
Bst2UI CCWGG 2 cut(s) 10, 275
Bst4CI ACNGT 2 cut(s) 51, 98
Bst6I CTCTTC 1 cut(s) 330
BstDEI CTNAG 1 cut(s) 162
BstF5I GGATG 1 cut(s) 96
BstH2I RGCGCY 1 cut(s) 208
BstHHI GCGC 1 cut(s) 207
BstKTI GATC 2 cut(s) 226, 314
BstMBI GATC 2 cut(s) 223, 311
BstMWI GCNNNNNNNGC 2 cut(s) 194, 287
BstNI CCWGG 2 cut(s) 10, 275
BstSCI CCNGG 2 cut(s) 8, 273
BstSFI CTRYAG 1 cut(s) 279
BstV1I GCAGC 1 cut(s) 265
BsuRI GGCC 2 cut(s) 145, 188
BtsCI GGATG 1 cut(s) 96
BtsIMutI CAGTG 1 cut(s) 125
CfoI GCGC 1 cut(s) 207
Csp6I GTAC 1 cut(s) 94
CviAII CATG 1 cut(s) 184
CviQI GTAC 1 cut(s) 94
DdeI CTNAG 1 cut(s) 162
DpnI GATC 2 cut(s) 225, 313
DpnII GATC 2 cut(s) 223, 311
Eam1104I CTCTTC 1 cut(s) 330
EarI CTCTTC 1 cut(s) 330
Eco47III AGCGCT 1 cut(s) 206
Eco88I CYCGRG 1 cut(s) 330
EcoRII CCWGG 2 cut(s) 8, 273
FaeI CATG 1 cut(s) 187
FaiI YATR 7 cut(s) 81, 185, 192, 210, 231, 350, 372
FaqI GGGAC 1 cut(s) 81
FatI CATG 1 cut(s) 183
Fnu4HI GCNGC 1 cut(s) 279
FokI GGATG 1 cut(s) 103
Fsp4HI GCNGC 1 cut(s) 279
FspBI CTAG 2 cut(s) 116, 380
GlaI GCGC 1 cut(s) 206
GluI GCNGC 1 cut(s) 279
HaeII RGCGCY 1 cut(s) 208
HaeIII GGCC 2 cut(s) 145, 188
HhaI GCGC 1 cut(s) 207
Hin1II CATG 1 cut(s) 187
Hin6I GCGC 1 cut(s) 205
HinP1I GCGC 1 cut(s) 205
HinfI GANTC 1 cut(s) 166
Hpy188I TCNGA 1 cut(s) 141
Hpy188III TCNNGA 2 cut(s) 315, 332
HpyAV CCTTC 1 cut(s) 67
HpyCH4III ACNGT 2 cut(s) 51, 98
HpyCH4IV ACGT 1 cut(s) 149
HpyCH4V TGCA 2 cut(s) 219, 281
HpyF10VI GCNNNNNNNGC 2 cut(s) 194, 287
HpyF3I CTNAG 1 cut(s) 162
HpySE526I ACGT 1 cut(s) 149
Hsp92II CATG 1 cut(s) 187
HspAI GCGC 1 cut(s) 205
Kzo9I GATC 2 cut(s) 223, 311
LpnPI CCDG 3 cut(s) 22, 260, 287
Lsp1109I GCAGC 1 cut(s) 265
MaeI CTAG 2 cut(s) 116, 380
MaeII ACGT 1 cut(s) 149
MaeIII GTNAC 1 cut(s) 343
MalI GATC 2 cut(s) 225, 313
MbiI CCGCTC 1 cut(s) 34
MboI GATC 2 cut(s) 223, 311
MboII GAAGA 2 cut(s) 321, 347
MfeI CAATTG 2 cut(s) 214, 236
MhlI GDGCHC 1 cut(s) 127
MluCI AATT 3 cut(s) 171, 214, 236
MnlI CCTC 4 cut(s) 78, 135, 187, 379
MseI TTAA 2 cut(s) 53, 320
MslI CAYNNNNRTG 1 cut(s) 255
MspR9I CCNGG 2 cut(s) 10, 275
MunI CAATTG 2 cut(s) 214, 236
MvaI CCWGG 2 cut(s) 10, 275
MwoI GCNNNNNNNGC 2 cut(s) 194, 287
NdeII GATC 2 cut(s) 223, 311
NlaIII CATG 1 cut(s) 187
OliI CACNNNNGTG 1 cut(s) 255
PaeR7I CTCGAG 1 cut(s) 330
PfeI GAWTC 1 cut(s) 166
PkrI GCNGC 1 cut(s) 280
PsiI TTATAA 1 cut(s) 231
Psp1406I AACGTT 1 cut(s) 149
Psp6I CCWGG 2 cut(s) 8, 273
PspGI CCWGG 2 cut(s) 8, 273
PstI CTGCAG 1 cut(s) 283
RsaI GTAC 1 cut(s) 95
RsaNI GTAC 1 cut(s) 94
RseI CAYNNNNRTG 1 cut(s) 255
SaqAI TTAA 2 cut(s) 53, 320
SatI GCNGC 1 cut(s) 279
Sau3AI GATC 2 cut(s) 223, 311
ScrFI CCNGG 2 cut(s) 10, 275
SduI GDGCHC 1 cut(s) 127
SetI ASST 4 cut(s) 21, 152, 266, 381
SfcI CTRYAG 1 cut(s) 279
Sfr274I CTCGAG 1 cut(s) 330
SlaI CTCGAG 1 cut(s) 330
SmiMI CAYNNNNRTG 1 cut(s) 255
SmlI CTYRAG 1 cut(s) 330
SmoI CTYRAG 1 cut(s) 330
Sse9I AATT 3 cut(s) 171, 214, 236
SsiI CCGC 2 cut(s) 34, 45
SspMI CTAG 2 cut(s) 116, 380
StyD4I CCNGG 2 cut(s) 8, 273
TaaI ACNGT 2 cut(s) 51, 98
TaiI ACGT 1 cut(s) 152
TaqI TCGA 2 cut(s) 60, 331
TasI AATT 3 cut(s) 171, 214, 236
TfiI GAWTC 1 cut(s) 166
Tru1I TTAA 2 cut(s) 53, 320
Tru9I TTAA 2 cut(s) 53, 320
TscAI CASTG 1 cut(s) 132
TseI GCWGC 1 cut(s) 278
TspRI CASTG 1 cut(s) 132
XapI RAATTY 1 cut(s) 171
XhoI CTCGAG 1 cut(s) 330
XspI CTAG 2 cut(s) 116, 380
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.