Rmu_sc0000451.1_g000003

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000451.1
Physical Location & Seq
Forward (+)
22649 .. 22978
330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000451.1_g000003.1.cds

Sequence Viewer

Length: 330 bp
atggcactcacgcctgaagctagtgttgccgccgggacggtcgcttcttcctcttcttcatcatcagctgttgagtggaagtatgatgtgtttttgagtttcaggggtcctgacactcaaaggagtaatacatccgatctataccattggctgcaaaacaagagaggaattacaacattcatggatgaccgagatcttctagtaggggatgcgatttctcccgttctcttaaaggcaattgaagaatcaaggtttgcaatcgttgttctgtcggaaaactatgcttcttctatctacttggtgtttggaggaactgacaaagatctgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

11.9

Weight (kDa)

4.61

Isoelectric Point (pI)

51.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020723)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000451.1_g000003 Rmu_sc0000483.1_g000036 Rmu_sc0006084.1_g000013
rosa_rugosa Rorug07G0263600
rosa_samantha Rh7CG445300
rosa_wichuraiana Rw7G035190

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 30
AcuI CTGAAG 1 cut(s) 36
AgsI TTSAA 1 cut(s) 242
AluBI AGCT 2 cut(s) 20, 68
AluI AGCT 2 cut(s) 20, 68
ApeKI GCWGC 1 cut(s) 151
AspS9I GGNCC 1 cut(s) 107
AsuC2I CCSGG 1 cut(s) 34
AvaII GGWCC 1 cut(s) 107
BbvI GCAGC 1 cut(s) 138
BcnI CCSGG 1 cut(s) 34
BfaI CTAG 2 cut(s) 21, 200
BglII AGATCT 2 cut(s) 193, 322
BisI GCNGC 2 cut(s) 30, 152
BlsI GCNGC 2 cut(s) 31, 153
Bme1390I CCNGG 1 cut(s) 34
Bme18I GGWCC 1 cut(s) 107
BmgT120I GGNCC 1 cut(s) 107
BmiI GGNNCC 1 cut(s) 108
BmrFI CCNGG 1 cut(s) 34
BmsI GCATC 1 cut(s) 199
BpuMI CCSGG 1 cut(s) 34
BseGI GGATG 3 cut(s) 131, 190, 214
BseXI GCAGC 1 cut(s) 138
Bsh1285I CGRYCG 1 cut(s) 42
BsiEI CGRYCG 1 cut(s) 42
BsiSI CCGG 1 cut(s) 33
BslFI GGGAC 1 cut(s) 49
BsmFI GGGAC 1 cut(s) 49
Bsp143I GATC 3 cut(s) 136, 193, 322
BspACI CCGC 1 cut(s) 30
BspLI GGNNCC 1 cut(s) 108
BssMI GATC 3 cut(s) 136, 193, 322
Bst4CI ACNGT 1 cut(s) 40
Bst6I CTCTTC 1 cut(s) 58
BstF5I GGATG 3 cut(s) 131, 190, 214
BstKTI GATC 3 cut(s) 139, 196, 325
BstMBI GATC 3 cut(s) 136, 193, 322
BstMCI CGRYCG 1 cut(s) 42
BstMWI GCNNNNNNNGC 1 cut(s) 26
BstSCI CCNGG 1 cut(s) 32
BstV1I GCAGC 1 cut(s) 138
BstX2I RGATCY 2 cut(s) 193, 322
BstYI RGATCY 2 cut(s) 193, 322
BtsCI GGATG 3 cut(s) 131, 190, 214
Cfr13I GGNCC 1 cut(s) 107
CviAII CATG 1 cut(s) 181
CviJI RGCY 3 cut(s) 20, 68, 151
CviKI_1 RGCY 3 cut(s) 20, 68, 151
DpnI GATC 3 cut(s) 138, 195, 324
DpnII GATC 3 cut(s) 136, 193, 322
Eam1104I CTCTTC 1 cut(s) 58
EarI CTCTTC 1 cut(s) 58
Eco47I GGWCC 1 cut(s) 107
Eco57I CTGAAG 1 cut(s) 36
EcoO109I RGGNCCY 1 cut(s) 107
FaeI CATG 1 cut(s) 184
FaiI YATR 4 cut(s) 84, 142, 182, 282
FaqI GGGAC 1 cut(s) 49
FatI CATG 1 cut(s) 180
Fnu4HI GCNGC 2 cut(s) 30, 152
FokI GGATG 3 cut(s) 118, 197, 221
Fsp4HI GCNGC 2 cut(s) 30, 152
FspBI CTAG 2 cut(s) 21, 200
GluI GCNGC 2 cut(s) 30, 152
HapII CCGG 1 cut(s) 33
Hin1II CATG 1 cut(s) 184
HinfI GANTC 1 cut(s) 245
HpaII CCGG 1 cut(s) 33
Hpy188I TCNGA 2 cut(s) 136, 274
Hpy188III TCNNGA 1 cut(s) 110
HpyCH4III ACNGT 1 cut(s) 40
HpyCH4V TGCA 2 cut(s) 154, 257
HpyF10VI GCNNNNNNNGC 1 cut(s) 26
Hsp92II CATG 1 cut(s) 184
Kzo9I GATC 3 cut(s) 136, 193, 322
LpnPI CCDG 4 cut(s) 27, 46, 88, 123
Lsp1109I GCAGC 1 cut(s) 138
LweI GCATC 1 cut(s) 199
MaeI CTAG 2 cut(s) 21, 200
MalI GATC 3 cut(s) 138, 195, 324
MboI GATC 3 cut(s) 136, 193, 322
MboII GAAGA 6 cut(s) 39, 45, 48, 188, 254, 279
MfeI CAATTG 1 cut(s) 237
MflI RGATCY 2 cut(s) 193, 322
MluCI AATT 2 cut(s) 168, 237
MmeI TCCRAC 1 cut(s) 252
MnlI CCTC 3 cut(s) 61, 158, 302
MseI TTAA 1 cut(s) 230
MspA1I CMGCKG 1 cut(s) 68
MspI CCGG 1 cut(s) 33
MspR9I CCNGG 1 cut(s) 34
MunI CAATTG 1 cut(s) 237
MwoI GCNNNNNNNGC 1 cut(s) 26
NciI CCSGG 1 cut(s) 34
NdeII GATC 3 cut(s) 136, 193, 322
NlaIII CATG 1 cut(s) 184
NlaIV GGNNCC 1 cut(s) 108
PfeI GAWTC 1 cut(s) 245
PkrI GCNGC 2 cut(s) 31, 153
PpuMI RGGWCCY 1 cut(s) 107
Psp5II RGGWCCY 1 cut(s) 107
PspN4I GGNNCC 1 cut(s) 108
PspPI GGNCC 1 cut(s) 107
PspPPI RGGWCCY 1 cut(s) 107
PsuI RGATCY 2 cut(s) 193, 322
PvuII CAGCTG 1 cut(s) 68
SaqAI TTAA 1 cut(s) 230
SatI GCNGC 2 cut(s) 30, 152
Sau3AI GATC 3 cut(s) 136, 193, 322
Sau96I GGNCC 1 cut(s) 107
ScrFI CCNGG 1 cut(s) 34
SetI ASST 3 cut(s) 22, 70, 254
SfaNI GCATC 1 cut(s) 199
SinI GGWCC 1 cut(s) 107
Sse9I AATT 2 cut(s) 168, 237
SsiI CCGC 1 cut(s) 30
SspMI CTAG 2 cut(s) 21, 200
StyD4I CCNGG 1 cut(s) 32
TaaI ACNGT 1 cut(s) 40
TaqII GACCGA 1 cut(s) 204
TasI AATT 2 cut(s) 168, 237
TauI GCSGC 1 cut(s) 32
TfiI GAWTC 1 cut(s) 245
Tru1I TTAA 1 cut(s) 230
Tru9I TTAA 1 cut(s) 230
TseI GCWGC 1 cut(s) 151
TspDTI ATGAA 2 cut(s) 48, 169
VpaK11BI GGWCC 1 cut(s) 107
XspI CTAG 2 cut(s) 21, 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.