Rmu_sc0000818.1_g000016

FH protein interacting protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000818.1
OG0020051
Physical Location & Seq
Reverse (-)
73348 .. 74792
1445 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 582 bp
atggaagtgccagctgatagtgagcagtgggtgaatcttaatgtctgcggcagaaaattgttgacaaccattgatacgctaacgcgggagccaaactcaatgcttgagacaatgtttagcgggagatacacattgaaggagaagaatggatatgtgatgatcgatagagatgggttttattttggatacatacttaggtggctgagagatggggtggttcccatattggaaccaatgttttacccagagctggcaattgaggcagattactaccaattgtgtggcctgaaggcatcacttcaggaggttatgttacgatgcaatgccgacttgtcaagaaaggaagttatcacaaggattgaacaccttttgggtgcctatcccttgctggatctcacctatctctcttttcaactaggctatctggttgatttattggtagataaaggtcttcttattggagatggtttgagttatgtggtctttggaaatttggtagatggatactttagaatcactattgatcccctcaacgatctctccatctggttggatgttactgatggtggctctgttctatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BTB_2 Pentapeptide

Protein Analysis

193

Amino Acids

21.98

Weight (kDa)

4.46

Isoelectric Point (pI)

29.31

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
BTB_2 PF02214 11 - 96 4.5e-14 BTB/POZ domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020051)

Species Orthologous Gene IDs
rosa_laevigata RLG00000036446
rosa_multiflora Rmu_sc0000818.1_g000016 Rmu_sc0015038.1_g000003
rosa_samantha Rh5AG486400 Rh5BG506700 Rh5CG530200
rosa_wichuraiana Rw5G045140

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 374
AccII CGCG 1 cut(s) 85
AciI CCGC 3 cut(s) 48, 85, 120
AclWI GGATC 2 cut(s) 399, 518
AcsI RAATTY 1 cut(s) 490
AcuI CTGAAG 2 cut(s) 284, 308
AfiI CCNNNNNNNGG 1 cut(s) 250
AgsI TTSAA 3 cut(s) 136, 362, 413
AluBI AGCT 2 cut(s) 14, 250
AluI AGCT 2 cut(s) 14, 250
Alw26I GTCTC 1 cut(s) 101
AlwI GGATC 2 cut(s) 399, 518
AoxI GGCC 1 cut(s) 283
ApoI RAATTY 1 cut(s) 490
AsuHPI GGTGA 2 cut(s) 43, 388
BanI GGYRCC 1 cut(s) 374
BbsI GAAGAC 1 cut(s) 443
BccI CCATC 6 cut(s) 164, 203, 458, 494, 551, 557
BciVI GTATCC 2 cut(s) 179, 497
BcoDI GTCTC 1 cut(s) 101
BfaI CTAG 1 cut(s) 416
BfmI CTRYAG 1 cut(s) 578
BfuI GTATCC 2 cut(s) 179, 497
BisI GCNGC 1 cut(s) 49
BlsI GCNGC 1 cut(s) 50
BmiI GGNNCC 4 cut(s) 90, 219, 231, 376
BmsI GCATC 2 cut(s) 302, 308
BpiI GAAGAC 1 cut(s) 443
BplI GAGNNNNNCTC 2 cut(s) 80, 112
BpuEI CTTGAG 1 cut(s) 125
Bsa29I ATCGAT 1 cut(s) 162
BsaXI ACNNNNNCTCC 4 cut(s) 296, 326, 524, 554
Bsc4I CCNNNNNNNGG 1 cut(s) 250
Bse3DI GCAATG 1 cut(s) 328
BseCI ATCGAT 1 cut(s) 162
BseGI GGATG 1 cut(s) 559
BseLI CCNNNNNNNGG 1 cut(s) 250
BseMI GCAATG 1 cut(s) 328
BseMII CTCAG 1 cut(s) 194
Bsh1236I CGCG 1 cut(s) 85
BshFI GGCC 1 cut(s) 285
BshNI GGYRCC 1 cut(s) 374
BshVI ATCGAT 1 cut(s) 162
BslI CCNNNNNNNGG 1 cut(s) 250
BsmAI GTCTC 1 cut(s) 101
BsnI GGCC 1 cut(s) 285
Bsp143I GATC 4 cut(s) 159, 391, 523, 535
BspACI CCGC 3 cut(s) 48, 85, 120
BspANI GGCC 1 cut(s) 285
BspCNI CTCAG 1 cut(s) 195
BspDI ATCGAT 1 cut(s) 162
BspFNI CGCG 1 cut(s) 85
BspLI GGNNCC 4 cut(s) 90, 219, 231, 376
BspPI GGATC 2 cut(s) 399, 518
BspT107I GGYRCC 1 cut(s) 374
BsrDI GCAATG 1 cut(s) 328
BssMI GATC 4 cut(s) 159, 391, 523, 535
BstC8I GCNNGC 2 cut(s) 12, 252
BstDEI CTNAG 2 cut(s) 194, 203
BstF5I GGATG 1 cut(s) 559
BstFNI CGCG 1 cut(s) 85
BstKTI GATC 4 cut(s) 162, 394, 526, 538
BstMAI GTCTC 1 cut(s) 101
BstMBI GATC 4 cut(s) 159, 391, 523, 535
BstMWI GCNNNNNNNGC 1 cut(s) 260
BstSFI CTRYAG 1 cut(s) 578
BstUI CGCG 1 cut(s) 85
BstV2I GAAGAC 1 cut(s) 443
BstX2I RGATCY 1 cut(s) 391
BstXI CCANNNNNNTGG 2 cut(s) 281, 550
BstYI RGATCY 1 cut(s) 391
Bsu15I ATCGAT 1 cut(s) 162
BsuI GTATCC 2 cut(s) 179, 497
BsuRI GGCC 1 cut(s) 285
BsuTUI ATCGAT 1 cut(s) 162
BtsCI GGATG 1 cut(s) 559
BtsI GCAGTG 1 cut(s) 32
BtsIMutI CAGTG 1 cut(s) 32
Cac8I GCNNGC 2 cut(s) 12, 252
ClaI ATCGAT 1 cut(s) 162
CviJI RGCY 7 cut(s) 14, 91, 202, 250, 285, 420, 570
CviKI_1 RGCY 7 cut(s) 14, 91, 202, 250, 285, 420, 570
DdeI CTNAG 2 cut(s) 194, 203
DpnI GATC 4 cut(s) 161, 393, 525, 537
DpnII GATC 4 cut(s) 159, 391, 523, 535
Eco57I CTGAAG 2 cut(s) 284, 308
FaiI YATR 6 cut(s) 153, 191, 224, 311, 477, 580
FalI AAGNNNNNCTT 2 cut(s) 438, 470
FauI CCCGC 2 cut(s) 78, 113
Fnu4HI GCNGC 1 cut(s) 49
FokI GGATG 1 cut(s) 566
Fsp4HI GCNGC 1 cut(s) 49
FspBI CTAG 1 cut(s) 416
GluI GCNGC 1 cut(s) 49
HaeIII GGCC 1 cut(s) 285
HincII GTYRAC 1 cut(s) 63
HindII GTYRAC 1 cut(s) 63
HinfI GANTC 2 cut(s) 34, 513
HphI GGTGA 2 cut(s) 43, 388
Hpy166II GTNNAC 1 cut(s) 63
Hpy188III TCNNGA 2 cut(s) 302, 336
Hpy8I GTNNAC 1 cut(s) 63
HpyAV CCTTC 2 cut(s) 130, 283
HpyCH4V TGCA 1 cut(s) 321
HpyF10VI GCNNNNNNNGC 1 cut(s) 260
HpyF3I CTNAG 2 cut(s) 194, 203
Kzo9I GATC 4 cut(s) 159, 391, 523, 535
LmnI GCTCC 1 cut(s) 88
LpnPI CCDG 8 cut(s) 24, 236, 258, 287, 299, 374, 410, 532
LweI GCATC 2 cut(s) 302, 308
MaeI CTAG 1 cut(s) 416
MaeIII GTNAC 2 cut(s) 312, 556
MalI GATC 4 cut(s) 161, 393, 525, 537
MboI GATC 4 cut(s) 159, 391, 523, 535
MboII GAAGA 2 cut(s) 154, 443
MfeI CAATTG 2 cut(s) 255, 275
MflI RGATCY 1 cut(s) 391
MluCI AATT 4 cut(s) 56, 255, 275, 490
MmeI TCCRAC 1 cut(s) 531
MnlI CCTC 3 cut(s) 253, 298, 539
MseI TTAA 1 cut(s) 39
MspA1I CMGCKG 1 cut(s) 14
MunI CAATTG 2 cut(s) 255, 275
MvnI CGCG 1 cut(s) 85
MwoI GCNNNNNNNGC 1 cut(s) 260
NdeII GATC 4 cut(s) 159, 391, 523, 535
NlaIV GGNNCC 4 cut(s) 90, 219, 231, 376
PfeI GAWTC 2 cut(s) 34, 513
PkrI GCNGC 1 cut(s) 50
PspN4I GGNNCC 4 cut(s) 90, 219, 231, 376
PsuI RGATCY 1 cut(s) 391
PvuII CAGCTG 1 cut(s) 14
SaqAI TTAA 1 cut(s) 39
SatI GCNGC 1 cut(s) 49
Sau3AI GATC 4 cut(s) 159, 391, 523, 535
SetI ASST 7 cut(s) 16, 200, 252, 309, 369, 401, 451
SfaNI GCATC 2 cut(s) 302, 308
SfcI CTRYAG 1 cut(s) 578
SmlI CTYRAG 1 cut(s) 104
SmoI CTYRAG 1 cut(s) 104
Sse9I AATT 4 cut(s) 56, 255, 275, 490
SsiI CCGC 3 cut(s) 48, 85, 120
SspMI CTAG 1 cut(s) 416
TaqI TCGA 1 cut(s) 162
TasI AATT 4 cut(s) 56, 255, 275, 490
TauI GCSGC 1 cut(s) 51
TfiI GAWTC 2 cut(s) 34, 513
Tru1I TTAA 1 cut(s) 39
Tru9I TTAA 1 cut(s) 39
TscAI CASTG 1 cut(s) 32
TspRI CASTG 1 cut(s) 32
XapI RAATTY 1 cut(s) 490
XspI CTAG 1 cut(s) 416
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.