Rmu_sc0000948.1_g000022

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000948.1
Physical Location & Seq
Forward (+)
106252 .. 106551
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000948.1_g000022.1.cds

Sequence Viewer

Length: 300 bp
atggtggtgaatcaggttaaaccagataatgttaccttcatcttcttgttgatggcttgcatccattctggattaataggggacagtcccatgctttttgaaacaatgcaaacaatttatggtctctctcctgagaaagatcatgtagcatgcgtggtggatatgcttgctagaggtggatacttagctgaagcaagggagcgggctgataggtattgttcagtatatgctaagactagcttgcgtgaagctctgcttggaacatgttctgcacacgggaagttgggatttggaaaatag

Protein Analysis

99

Amino Acids

10.83

Weight (kDa)

6.81

Isoelectric Point (pI)

21.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019383)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0118031
rosa_laevigata RLG00000018388
rosa_multiflora Rmu_sc0000948.1_g000022
rosa_roxburghii Rroxscaffold_2G00126040
rosa_samantha Rh2AG272200 Rh2BG284200 Rh2DG298400
rosa_wichuraiana Rw2G021510

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 202
AciI CCGC 1 cut(s) 202
AcuI CTGAAG 1 cut(s) 210
AflIII ACRYGT 1 cut(s) 263
AgsI TTSAA 1 cut(s) 101
AjuI GAANNNNNNNTTGG 2 cut(s) 240, 272
AluBI AGCT 3 cut(s) 188, 240, 251
AluI AGCT 3 cut(s) 188, 240, 251
Alw26I GTCTC 1 cut(s) 128
AseI ATTAAT 1 cut(s) 74
Asp700I GAANNNNTTC 1 cut(s) 265
AsuHPI GGTGA 1 cut(s) 19
BccI CCATC 1 cut(s) 46
BciVI GTATCC 1 cut(s) 173
BcoDI GTCTC 1 cut(s) 128
BfaI CTAG 2 cut(s) 171, 237
BfuI GTATCC 1 cut(s) 173
BmsI GCATC 1 cut(s) 69
BsaI GGTCTC 1 cut(s) 128
BseGI GGATG 1 cut(s) 60
BseMII CTCAG 1 cut(s) 123
BsgI GTGCAG 1 cut(s) 255
BslFI GGGAC 2 cut(s) 72, 95
BsmAI GTCTC 1 cut(s) 128
BsmFI GGGAC 2 cut(s) 72, 95
Bso31I GGTCTC 1 cut(s) 128
Bsp143I GATC 1 cut(s) 139
BspACI CCGC 1 cut(s) 202
BspCNI CTCAG 1 cut(s) 124
BspTNI GGTCTC 1 cut(s) 128
BsrBI CCGCTC 1 cut(s) 202
BssMI GATC 1 cut(s) 139
Bst4CI ACNGT 1 cut(s) 86
BstC8I GCNNGC 5 cut(s) 58, 151, 168, 204, 242
BstDEI CTNAG 3 cut(s) 132, 184, 231
BstF5I GGATG 1 cut(s) 60
BstKTI GATC 1 cut(s) 142
BstMAI GTCTC 1 cut(s) 128
BstMBI GATC 1 cut(s) 139
BstNSI RCATGY 2 cut(s) 153, 267
BsuI GTATCC 1 cut(s) 173
BtsCI GGATG 1 cut(s) 60
Cac8I GCNNGC 5 cut(s) 58, 151, 168, 204, 242
CviAII CATG 4 cut(s) 91, 143, 150, 264
CviJI RGCY 5 cut(s) 56, 188, 206, 240, 251
CviKI_1 RGCY 5 cut(s) 56, 188, 206, 240, 251
DdeI CTNAG 3 cut(s) 132, 184, 231
DpnI GATC 1 cut(s) 141
DpnII GATC 1 cut(s) 139
Eco31I GGTCTC 1 cut(s) 128
Eco57I CTGAAG 1 cut(s) 210
FaeI CATG 4 cut(s) 94, 146, 153, 267
FaiI YATR 8 cut(s) 92, 120, 144, 151, 164, 226, 228, 265
FalI AAGNNNNNCTT 4 cut(s) 224, 256, 240, 272
FaqI GGGAC 2 cut(s) 72, 95
FatI CATG 4 cut(s) 90, 142, 149, 263
FauI CCCGC 1 cut(s) 195
FokI GGATG 1 cut(s) 47
FspBI CTAG 2 cut(s) 171, 237
Hin1II CATG 4 cut(s) 94, 146, 153, 267
HinfI GANTC 1 cut(s) 10
HphI GGTGA 1 cut(s) 19
Hpy188III TCNNGA 2 cut(s) 69, 131
HpyAV CCTTC 1 cut(s) 46
HpyCH4III ACNGT 1 cut(s) 86
HpyCH4V TGCA 3 cut(s) 60, 109, 272
HpyF3I CTNAG 3 cut(s) 132, 184, 231
Hsp92II CATG 4 cut(s) 94, 146, 153, 267
Kzo9I GATC 1 cut(s) 139
LmnI GCTCC 1 cut(s) 199
LpnPI CCDG 3 cut(s) 36, 54, 144
LweI GCATC 1 cut(s) 69
MaeI CTAG 2 cut(s) 171, 237
MaeIII GTNAC 1 cut(s) 31
MalI GATC 1 cut(s) 141
MbiI CCGCTC 1 cut(s) 202
MboI GATC 1 cut(s) 139
MboII GAAGA 1 cut(s) 34
MluCI AATT 1 cut(s) 114
MnlI CCTC 1 cut(s) 167
MroXI GAANNNNTTC 1 cut(s) 265
MseI TTAA 2 cut(s) 18, 74
NdeII GATC 1 cut(s) 139
NlaIII CATG 4 cut(s) 94, 146, 153, 267
NspI RCATGY 2 cut(s) 153, 267
PaeI GCATGC 1 cut(s) 153
PciI ACATGT 1 cut(s) 263
PdmI GAANNNNTTC 1 cut(s) 265
PfeI GAWTC 1 cut(s) 10
PscI ACATGT 1 cut(s) 263
PshBI ATTAAT 1 cut(s) 74
SaqAI TTAA 2 cut(s) 18, 74
Sau3AI GATC 1 cut(s) 139
SetI ASST 7 cut(s) 18, 38, 178, 190, 215, 242, 253
SfaNI GCATC 1 cut(s) 69
SphI GCATGC 1 cut(s) 153
Sse9I AATT 1 cut(s) 114
SsiI CCGC 1 cut(s) 202
SspMI CTAG 2 cut(s) 171, 237
TaaI ACNGT 1 cut(s) 86
TasI AATT 1 cut(s) 114
TfiI GAWTC 1 cut(s) 10
Tru1I TTAA 2 cut(s) 18, 74
Tru9I TTAA 2 cut(s) 18, 74
TspDTI ATGAA 1 cut(s) 28
VspI ATTAAT 1 cut(s) 74
XceI RCATGY 2 cut(s) 153, 267
XmnI GAANNNNTTC 1 cut(s) 265
XspI CTAG 2 cut(s) 171, 237
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.