Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001065.1

Orthogroup ID

OG0014207

Physical Location & Seq

Genomic Coordinates Reverse (-)

68939 .. 70249

Gene Structure 1311 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001065.1_g000018.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1311 bp

atgaacaaaaaccagacacacaggacgcgtccgtggcctggcttccccacgtcgtcgaagctcaccaacttcggcgacgccaactgcatggagcagctactagtccactgcgccaaagccatcgagaccaacgacgccacgttggcgcagcagatcttgtgggttctcaacaacattgctcccccggacggcgactcgaaccagcgcctcacgtgcgcttttcttcgagcactcatcgctcgtgcggccaggagcggaagtcttaagctccttgcggcaatgaacgccgcccaggctaacctcgccattcacactcataaattctccgtcatcgagctcgccgggtttattgatctcacgccgtggcaccggtttggcttcaccgccgcaaactctgtcattctcgaagcggtggaaggctactccgttatccacatcgttgacttgagtttgactcactgcatgcaaattccaactctggtcgatgccattgcttctcgtcaggacgggttaactactcctccgctgctgaagctcactgtagccggaacaacagaggacgtgccgccgatgctggatctttcgtacgaggagctgggatcgaaattggtcaattttgcaagatcccggaacataatcctagagtttagagtcatcccttcgagttatacagatggatttgcaaacttaatcgagcaacttcgggtccagaacttggtgtacccagagagtggacatgaggctctagtcataaactgtcacatgatgctccattacattccggaagagacgtttcagaatttcgagccttgttcttcgtcctcaacatccatcactacttcctccacttcactgaggtcgatgtttttgaaagccgttcggggtttggacccaaccgtcgtcgttgtggtggacgaggacgctgacttgacttccaacgatttggtggggaggctgaggtcggctttcaactatctgtggattccttatgatactgttgacacgtttctgccgaggggaagcaagcagaggcagtggtacgaggccgatatgtgctggaaaatcgagaatgtgattgcctacgagggatttcagagggtcgagaggctggagcccaaatgccggtgggtgcagcggatgaggagcgccgggtttcgaagcgtttcgttcggagaggaggctgtgaatgaggtgaaagctatgctggatgagcacgcggcggggtgggggttgaagagggaagaagaagatcttgtgcttacttggaagggacacaatgttgtttttgccactgcttggatgcctgcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003677 GO:0003700 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006355 GO:0008150 GO:0009889 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0031323 GO:0031326 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043565 GO:0044424 GO:0044464 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090 GO:0097159 GO:0140110 GO:1901363 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

GRAS

Protein Analysis

436

Amino Acids

48.84

Weight (kDa)

5.68

Isoelectric Point (pI)

46.86

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014207)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G49950
fragaria_vesca	FvH4_1g17370
malus_domestica	MD00G1112400.v1.1 MD15G1294400.v1.1 MD15G1294600.v1.1
prunus_persica	Prupe.6G223200_v2.0.a1
pyrus_communis	pycom02g14830
rosa_chinensis	RchiOBHm_Chr2g0107531
rosa_laevigata	RLG00000017589
rosa_multiflora	Rmu_co8494603.1_g000001 Rmu_sc0001065.1_g000018
rosa_rugosa	Rorug02G0144800
rosa_samantha	Rh2AG194600 Rh2BG207300 Rh2CG199800 Rh2DG201900
rosa_wichuraiana	Rw2G015420

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	896
AccB1I	GGYRCC	1 cut(s)	366
AccB7I	CCANNNNNTGG	3 cut(s)	715, 731, 1296
AccBSI	CCGCTC	1 cut(s)	255
AccII	CGCG	2 cut(s)	28, 1217
AccIII	TCCGGA	1 cut(s)	781
AclWI	GGATC	3 cut(s)	585, 607, 618
AcoI	YGGCCR	1 cut(s)	246
AcsI	RAATTY	3 cut(s)	320, 468, 799
AcuI	CTGAAG	1 cut(s)	551
AcvI	CACGTG	1 cut(s)	213
AcyI	GRCGYC	2 cut(s)	78, 135
AdeI	CACNNNGTG	1 cut(s)	363
AfaI	GTAC	3 cut(s)	587, 722, 1040
AfiI	CCNNNNNNNGG	6 cut(s)	38, 188, 715, 731, 1122, 1296
AflII	CTTAAG	1 cut(s)	263
AflIII	ACRYGT	2 cut(s)	26, 1002
AgeI	ACCGGT	1 cut(s)	369
AgsI	TTSAA	3 cut(s)	871, 970, 1234
AhlI	ACTAGT	1 cut(s)	100
AjiI	CACGTC	2 cut(s)	51, 562
AjnI	CCWGG	3 cut(s)	37, 248, 291
AluBI	AGCT	7 cut(s)	61, 97, 268, 337, 535, 595, 1199
AluI	AGCT	7 cut(s)	61, 97, 268, 337, 535, 595, 1199
Alw21I	GWGCWC	3 cut(s)	232, 339, 1215
Alw26I	GTCTC	2 cut(s)	119, 782
AlwI	GGATC	3 cut(s)	585, 607, 618
Aor13HI	TCCGGA	1 cut(s)	781
AoxI	GGCC	3 cut(s)	35, 246, 1044
ApeKI	GCWGC	4 cut(s)	94, 148, 526, 1132
ApoI	RAATTY	3 cut(s)	320, 468, 799
AsiGI	ACCGGT	1 cut(s)	369
Asp700I	GAANNNNTTC	1 cut(s)	1162
AspLEI	GCGC	5 cut(s)	113, 148, 207, 218, 1148
AspS9I	GGNCC	2 cut(s)	706, 889
AsuC2I	CCSGG	4 cut(s)	185, 343, 628, 1150
AsuHPI	GGTGA	3 cut(s)	55, 373, 1204
AsuII	TTCGAA	1 cut(s)	1156
AvaII	GGWCC	2 cut(s)	706, 889
BanI	GGYRCC	1 cut(s)	366
BanII	GRGCYC	2 cut(s)	339, 1116
BauI	CACGAG	1 cut(s)	240
BbrPI	CACGTG	1 cut(s)	213
Bbv12I	GWGCWC	3 cut(s)	232, 339, 1215
BbvCI	CCTCAGC	1 cut(s)	956
BbvI	GCAGC	4 cut(s)	106, 160, 513, 1144
BccI	CCATC	3 cut(s)	128, 668, 839
BceAI	ACGGC	3 cut(s)	205, 346, 860
BcgI	CGANNNNNNTGC	2 cut(s)	473, 507
BciT130I	CCWGG	3 cut(s)	39, 250, 293
BcnI	CCSGG	4 cut(s)	185, 343, 628, 1150
BcoDI	GTCTC	2 cut(s)	119, 782
BcuI	ACTAGT	1 cut(s)	100
BfaI	CTAG	3 cut(s)	101, 641, 746
BfmI	CTRYAG	1 cut(s)	540
BfoI	RGCGCY	2 cut(s)	208, 1149
BfrI	CTTAAG	1 cut(s)	263
BglI	GCCNNNNNGGC	2 cut(s)	143, 293
BglII	AGATCT	2 cut(s)	153, 1249
Bme1390I	CCNGG	7 cut(s)	39, 185, 250, 293, 343, 628, 1150
Bme18I	GGWCC	2 cut(s)	706, 889
BmgBI	CACGTC	2 cut(s)	51, 562
BmgT120I	GGNCC	2 cut(s)	706, 889
BmiI	GGNNCC	4 cut(s)	368, 707, 891, 1113
BmrFI	CCNGG	7 cut(s)	39, 185, 250, 293, 343, 628, 1150
BmsI	GCATC	4 cut(s)	475, 561, 756, 1290
BplI	GAGNNNNNCTC	2 cut(s)	439, 471
BpmI	CTGGAG	1 cut(s)	1130
Bpu10I	CCTNAGC	1 cut(s)	956
Bpu14I	TTCGAA	1 cut(s)	1156
BpuEI	CTTGAG	1 cut(s)	466
BpuMI	CCSGG	4 cut(s)	185, 343, 628, 1150
BsaAI	YACGTR	1 cut(s)	213
BsaHI	GRCGYC	2 cut(s)	78, 135
BsaI	GGTCTC	1 cut(s)	119
BsaJI	CCNNGG	5 cut(s)	32, 183, 291, 362, 1013
BsaWI	WCCGGW	2 cut(s)	369, 781
BsaXI	ACNNNNNCTCC	4 cut(s)	244, 274, 505, 535
Bsc4I	CCNNNNNNNGG	6 cut(s)	38, 188, 715, 731, 1122, 1296
Bse118I	RCCGGY	2 cut(s)	369, 1122
Bse3DI	GCAATG	3 cut(s)	174, 285, 489
BseAI	TCCGGA	1 cut(s)	781
BseBI	CCWGG	3 cut(s)	39, 250, 293
BseDI	CCNNGG	5 cut(s)	32, 183, 291, 362, 1013
BseGI	GGATG	5 cut(s)	654, 827, 1143, 1213, 1305
BseLI	CCNNNNNNNGG	6 cut(s)	38, 188, 715, 731, 1122, 1296
BseMI	GCAATG	3 cut(s)	174, 285, 489
BseMII	CTCAG	2 cut(s)	845, 947
BseRI	GAGGAG	4 cut(s)	510, 605, 1156, 1190
BseXI	GCAGC	4 cut(s)	106, 160, 513, 1144
BseYI	CCCAGC	1 cut(s)	595
BsgI	GTGCAG	1 cut(s)	1151
Bsh1236I	CGCG	2 cut(s)	28, 1217
BshFI	GGCC	3 cut(s)	37, 248, 1046
BshNI	GGYRCC	1 cut(s)	366
BshTI	ACCGGT	1 cut(s)	369
BsiHKAI	GWGCWC	3 cut(s)	232, 339, 1215
BsiSI	CCGG	8 cut(s)	185, 342, 370, 546, 628, 782, 1123, 1149
BsiWI	CGTACG	1 cut(s)	585
BslFI	GGGAC	1 cut(s)	1284
BslI	CCNNNNNNNGG	6 cut(s)	38, 188, 715, 731, 1122, 1296
BsmAI	GTCTC	2 cut(s)	119, 782
BsmBI	CGTCTC	1 cut(s)	782
BsmFI	GGGAC	1 cut(s)	1284
BsnI	GGCC	3 cut(s)	37, 248, 1046
Bso31I	GGTCTC	1 cut(s)	119
Bsp119I	TTCGAA	1 cut(s)	1156
Bsp1286I	GDGCHC	4 cut(s)	232, 339, 1116, 1215
Bsp13I	TCCGGA	1 cut(s)	781
Bsp143I	GATC	6 cut(s)	153, 352, 577, 599, 623, 1249
BspANI	GGCC	3 cut(s)	37, 248, 1046
BspCNI	CTCAG	2 cut(s)	846, 948
BspEI	TCCGGA	1 cut(s)	781
BspFNI	CGCG	2 cut(s)	28, 1217
BspLI	GGNNCC	4 cut(s)	368, 707, 891, 1113
BspPI	GGATC	3 cut(s)	585, 607, 618
BspT104I	TTCGAA	1 cut(s)	1156
BspT107I	GGYRCC	1 cut(s)	366
BspTI	CTTAAG	1 cut(s)	263
BspTNI	GGTCTC	1 cut(s)	119
BsrBI	CCGCTC	1 cut(s)	255
BsrDI	GCAATG	3 cut(s)	174, 285, 489
BsrFI	RCCGGY	2 cut(s)	369, 1122
BssAI	RCCGGY	2 cut(s)	369, 1122
BssECI	CCNNGG	5 cut(s)	32, 183, 291, 362, 1013
BssMI	GATC	6 cut(s)	153, 352, 577, 599, 623, 1249
BssNI	GRCGYC	2 cut(s)	78, 135
BssSI	CACGAG	1 cut(s)	240
Bst2BI	CACGAG	1 cut(s)	240
Bst2UI	CCWGG	3 cut(s)	39, 250, 293
Bst4CI	ACNGT	4 cut(s)	541, 758, 898, 997
Bst6I	CTCTTC	2 cut(s)	780, 1229
BstACI	GRCGYC	2 cut(s)	78, 135
BstAFI	CTTAAG	1 cut(s)	263
BstBAI	YACGTR	1 cut(s)	213
BstBI	TTCGAA	1 cut(s)	1156
BstC8I	GCNNGC	5 cut(s)	339, 464, 1025, 1215, 1305
BstDEI	CTNAG	2 cut(s)	854, 956
BstDSI	CCRYGG	2 cut(s)	32, 362
BstF5I	GGATG	5 cut(s)	654, 827, 1143, 1213, 1305
BstFNI	CGCG	2 cut(s)	28, 1217
BstH2I	RGCGCY	2 cut(s)	208, 1149
BstHHI	GCGC	5 cut(s)	113, 148, 207, 218, 1148
BstKTI	GATC	6 cut(s)	156, 355, 580, 602, 626, 1252
BstMAI	GTCTC	2 cut(s)	119, 782
BstMBI	GATC	6 cut(s)	153, 352, 577, 599, 623, 1249
BstNI	CCWGG	3 cut(s)	39, 250, 293
BstNSI	RCATGY	1 cut(s)	466
BstSCI	CCNGG	7 cut(s)	37, 183, 248, 291, 341, 626, 1148
BstSFI	CTRYAG	1 cut(s)	540
BstUI	CGCG	2 cut(s)	28, 1217
BstV1I	GCAGC	4 cut(s)	106, 160, 513, 1144
BstX2I	RGATCY	4 cut(s)	153, 577, 623, 1249
BstXI	CCANNNNNNTGG	2 cut(s)	88, 943
BstYI	RGATCY	4 cut(s)	153, 577, 623, 1249
BsuRI	GGCC	3 cut(s)	37, 248, 1046
BtgI	CCRYGG	2 cut(s)	32, 362
BtgZI	GCGATG	1 cut(s)	220
BtrI	CACGTC	2 cut(s)	51, 562
BtsCI	GGATG	5 cut(s)	654, 827, 1143, 1213, 1305
BtsI	GCAGTG	4 cut(s)	106, 457, 1040, 1290
BtsIMutI	CAGTG	6 cut(s)	106, 457, 537, 851, 1040, 1290
Cac8I	GCNNGC	5 cut(s)	339, 464, 1025, 1215, 1305
CfoI	GCGC	5 cut(s)	113, 148, 207, 218, 1148
Cfr10I	RCCGGY	2 cut(s)	369, 1122
Cfr13I	GGNCC	2 cut(s)	706, 889
CseI	GACGC	5 cut(s)	17, 34, 86, 143, 929
Csp6I	GTAC	3 cut(s)	586, 721, 1039
CspAI	ACCGGT	1 cut(s)	369
CviAII	CATG	4 cut(s)	88, 463, 737, 763
CviQI	GTAC	3 cut(s)	586, 721, 1039
DdeI	CTNAG	2 cut(s)	854, 956
DpnI	GATC	6 cut(s)	155, 354, 579, 601, 625, 1251
DpnII	GATC	6 cut(s)	153, 352, 577, 599, 623, 1249
DraIII	CACNNNGTG	1 cut(s)	363
DrdI	GACNNNNNNGTC	1 cut(s)	896
DseDI	GACNNNNNNGTC	1 cut(s)	896
EaeI	YGGCCR	1 cut(s)	246
Eam1104I	CTCTTC	2 cut(s)	780, 1229
EarI	CTCTTC	2 cut(s)	780, 1229
Ecl136II	GAGCTC	1 cut(s)	337
Eco24I	GRGCYC	2 cut(s)	339, 1116
Eco31I	GGTCTC	1 cut(s)	119
Eco47I	GGWCC	2 cut(s)	706, 889
Eco53kI	GAGCTC	1 cut(s)	337
Eco57I	CTGAAG	1 cut(s)	551
Eco72I	CACGTG	1 cut(s)	213
EcoICRI	GAGCTC	1 cut(s)	337
EcoRII	CCWGG	3 cut(s)	37, 248, 291
EcoT38I	GRGCYC	2 cut(s)	339, 1116
Esp3I	CGTCTC	1 cut(s)	782
FaeI	CATG	4 cut(s)	91, 466, 740, 766
FalI	AAGNNNNNCTT	2 cut(s)	1236, 1268
FaqI	GGGAC	1 cut(s)	1284
FatI	CATG	4 cut(s)	87, 462, 736, 762
FauI	CCCGC	1 cut(s)	1213
FokI	GGATG	4 cut(s)	641, 814, 1150, 1220
FriOI	GRGCYC	2 cut(s)	339, 1116
FspBI	CTAG	3 cut(s)	101, 641, 746
GlaI	GCGC	5 cut(s)	112, 147, 206, 217, 1147
GsaI	CCCAGC	1 cut(s)	599
GsuI	CTGGAG	1 cut(s)	1130
HaeII	RGCGCY	2 cut(s)	208, 1149
HaeIII	GGCC	3 cut(s)	37, 248, 1046
HapII	CCGG	8 cut(s)	185, 342, 370, 546, 628, 782, 1123, 1149
HgaI	GACGC	5 cut(s)	17, 34, 86, 143, 929
HhaI	GCGC	5 cut(s)	113, 148, 207, 218, 1148
Hin1I	GRCGYC	2 cut(s)	78, 135
Hin1II	CATG	4 cut(s)	91, 466, 740, 766
Hin6I	GCGC	5 cut(s)	111, 146, 205, 216, 1146
HinP1I	GCGC	5 cut(s)	111, 146, 205, 216, 1146
HincII	GTYRAC	3 cut(s)	442, 513, 1000
HindII	GTYRAC	3 cut(s)	442, 513, 1000
HinfI	GANTC	4 cut(s)	194, 454, 651, 982
HpaI	GTTAAC	1 cut(s)	513
HpaII	CCGG	8 cut(s)	185, 342, 370, 546, 628, 782, 1123, 1149
HphI	GGTGA	3 cut(s)	55, 373, 1204
Hpy166II	GTNNAC	7 cut(s)	106, 442, 513, 721, 734, 913, 1000
Hpy188I	TCNGA	3 cut(s)	798, 1095, 1172
Hpy188III	TCNNGA	7 cut(s)	124, 404, 503, 709, 782, 1066, 1102
Hpy8I	GTNNAC	7 cut(s)	106, 442, 513, 721, 734, 913, 1000
Hpy99I	CGWCG	6 cut(s)	55, 58, 80, 137, 902, 905
HpyAV	CCTTC	3 cut(s)	410, 669, 1261
HpyCH4III	ACNGT	4 cut(s)	541, 758, 898, 997
HpyCH4IV	ACGT	6 cut(s)	50, 140, 212, 561, 791, 1004
HpyCH4V	TGCA	6 cut(s)	87, 462, 466, 620, 683, 1132
HpyF3I	CTNAG	2 cut(s)	854, 956
HpySE526I	ACGT	6 cut(s)	50, 140, 212, 561, 791, 1004
Hsp92I	GRCGYC	2 cut(s)	78, 135
Hsp92II	CATG	4 cut(s)	91, 466, 740, 766
HspAI	GCGC	5 cut(s)	111, 146, 205, 216, 1146
Kpn2I	TCCGGA	1 cut(s)	781
KspAI	GTTAAC	1 cut(s)	513
Kzo9I	GATC	6 cut(s)	153, 352, 577, 599, 623, 1249
LmnI	GCTCC	8 cut(s)	91, 184, 252, 273, 592, 774, 1111, 1143
Lsp1109I	GCAGC	4 cut(s)	106, 160, 513, 1144
LweI	GCATC	4 cut(s)	475, 561, 756, 1290
MaeI	CTAG	3 cut(s)	101, 641, 746
MaeII	ACGT	6 cut(s)	50, 140, 212, 561, 791, 1004
MaeIII	GTNAC	1 cut(s)	758
MalI	GATC	6 cut(s)	155, 354, 579, 601, 625, 1251
MbiI	CCGCTC	1 cut(s)	255
MboI	GATC	6 cut(s)	153, 352, 577, 599, 623, 1249
MboII	GAAGA	7 cut(s)	215, 797, 807, 1246, 1253, 1256, 1259
MflI	RGATCY	4 cut(s)	153, 577, 623, 1249
MhlI	GDGCHC	4 cut(s)	232, 339, 1116, 1215
MluCI	AATT	5 cut(s)	320, 468, 605, 613, 799
MluI	ACGCGT	1 cut(s)	26
MlyI	GAGTC	3 cut(s)	188, 448, 660
MmeI	TCCRAC	2 cut(s)	497, 960
MroI	TCCGGA	1 cut(s)	781
MroXI	GAANNNNTTC	1 cut(s)	1162
MseI	TTAA	3 cut(s)	264, 512, 689
MspA1I	CMGCKG	2 cut(s)	526, 1135
MspCI	CTTAAG	1 cut(s)	263
MspI	CCGG	8 cut(s)	185, 342, 370, 546, 628, 782, 1123, 1149
MspR9I	CCNGG	7 cut(s)	39, 185, 250, 293, 343, 628, 1150
MvaI	CCWGG	3 cut(s)	39, 250, 293
MvnI	CGCG	2 cut(s)	28, 1217
NciI	CCSGG	4 cut(s)	185, 343, 628, 1150
NdeII	GATC	6 cut(s)	153, 352, 577, 599, 623, 1249
NlaIII	CATG	4 cut(s)	91, 466, 740, 766
NlaIV	GGNNCC	4 cut(s)	368, 707, 891, 1113
NmeAIII	GCCGAG	1 cut(s)	1038
NmuCI	GTSAC	1 cut(s)	758
NspI	RCATGY	1 cut(s)	466
NspV	TTCGAA	1 cut(s)	1156
PaeI	GCATGC	1 cut(s)	466
PcsI	WCGNNNNNNNCGW	2 cut(s)	129, 1010
PdmI	GAANNNNTTC	1 cut(s)	1162
PfeI	GAWTC	1 cut(s)	982
Pfl23II	CGTACG	1 cut(s)	585
PflMI	CCANNNNNTGG	3 cut(s)	715, 731, 1296
PfoI	TCCNGGA	1 cut(s)	626
PinAI	ACCGGT	1 cut(s)	369
PleI	GAGTC	3 cut(s)	188, 448, 659
PmaCI	CACGTG	1 cut(s)	213
PmlI	CACGTG	1 cut(s)	213
PpsI	GAGTC	3 cut(s)	188, 448, 659
Ppu21I	YACGTR	1 cut(s)	213
Psp124BI	GAGCTC	1 cut(s)	339
Psp6I	CCWGG	3 cut(s)	37, 248, 291
PspCI	CACGTG	1 cut(s)	213
PspFI	CCCAGC	1 cut(s)	595
PspGI	CCWGG	3 cut(s)	37, 248, 291
PspLI	CGTACG	1 cut(s)	585
PspN4I	GGNNCC	4 cut(s)	368, 707, 891, 1113
PspPI	GGNCC	2 cut(s)	706, 889
PsrI	GAACNNNNNNTAC	2 cut(s)	704, 736
PsuI	RGATCY	4 cut(s)	153, 577, 623, 1249
RsaI	GTAC	3 cut(s)	587, 722, 1040
RsaNI	GTAC	3 cut(s)	586, 721, 1039
SacI	GAGCTC	1 cut(s)	339
SaqAI	TTAA	3 cut(s)	264, 512, 689
Sau3AI	GATC	6 cut(s)	153, 352, 577, 599, 623, 1249
Sau96I	GGNCC	2 cut(s)	706, 889
SchI	GAGTC	3 cut(s)	188, 448, 660
ScrFI	CCNGG	7 cut(s)	39, 185, 250, 293, 343, 628, 1150
SduI	GDGCHC	4 cut(s)	232, 339, 1116, 1215
SfaNI	GCATC	4 cut(s)	475, 561, 756, 1290
SfcI	CTRYAG	1 cut(s)	540
SfuI	TTCGAA	1 cut(s)	1156
SinI	GGWCC	2 cut(s)	706, 889
SmlI	CTYRAG	2 cut(s)	263, 445
SmoI	CTYRAG	2 cut(s)	263, 445
SpeI	ACTAGT	1 cut(s)	100
SphI	GCATGC	1 cut(s)	466
Sse9I	AATT	5 cut(s)	320, 468, 605, 613, 799
SspMI	CTAG	3 cut(s)	101, 641, 746
SstI	GAGCTC	1 cut(s)	339
StyD4I	CCNGG	7 cut(s)	37, 183, 248, 291, 341, 626, 1148
TaaI	ACNGT	4 cut(s)	541, 758, 898, 997
TaiI	ACGT	6 cut(s)	53, 143, 215, 564, 794, 1007
TasI	AATT	5 cut(s)	320, 468, 605, 613, 799
TauI	GCSGC	6 cut(s)	248, 278, 290, 389, 568, 1220
TfiI	GAWTC	1 cut(s)	982
Tru1I	TTAA	3 cut(s)	264, 512, 689
Tru9I	TTAA	3 cut(s)	264, 512, 689
TscAI	CASTG	6 cut(s)	113, 464, 544, 858, 1040, 1297
TseFI	GTSAC	1 cut(s)	758
TseI	GCWGC	4 cut(s)	94, 148, 526, 1132
Tsp45I	GTSAC	1 cut(s)	758
TspDTI	ATGAA	2 cut(s)	17, 296
TspGWI	ACGGA	3 cut(s)	21, 316, 415
TspRI	CASTG	6 cut(s)	113, 464, 544, 858, 1040, 1297
Van91I	CCANNNNNTGG	3 cut(s)	715, 731, 1296
Vha464I	CTTAAG	1 cut(s)	263
VpaK11BI	GGWCC	2 cut(s)	706, 889
XapI	RAATTY	3 cut(s)	320, 468, 799
XceI	RCATGY	1 cut(s)	466
XcmI	CCANNNNNNNNNTGG	1 cut(s)	943
XmnI	GAANNNNTTC	1 cut(s)	1162
XspI	CTAG	3 cut(s)	101, 641, 746

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.