Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001072.1

Orthogroup ID

OG0019339

Physical Location & Seq

Genomic Coordinates Reverse (-)

33441 .. 33848

Gene Structure 408 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001072.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 408 bp

atgtgtattcttttgggggtcctggctttggagcttataactggtcgtccagctttgaattatcttcagcaaagccttgttatttgggcaaggcccctgcttaaagcaaacgacctcaaggagcttgttaatccttatattggtattggtgacaactatgacagcacagagctggatcatatggtgtggactgcatctttatgcatagaacagtctcctattctacatcctctcatgagtcaggttgaggtactggaggtgacgagtattctccaagtgtgccaaagaaatgaaaaggaggtccctgcagaggacatacttagaagaatgttggatgcacaagcatataactcaacaaactatctgagggatctcaaccgacacaagcagattgcttttggctcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0004675 GO:0004888 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007154 GO:0007165 GO:0007166 GO:0007167 GO:0007178 GO:0008150 GO:0008152 GO:0009987 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019199 GO:0019538 GO:0019899 GO:0023052 GO:0036211 GO:0038023 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0051020 GO:0051716 GO:0060089 GO:0065007 GO:0071704 GO:0071944 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko04010 ko04064 ko04620 ko04621 ko04624 ko04722 ko05133 ko05140 ko05142 ko05145 ko05152 ko05162 ko05164 map04010 map04064 map04620 map04621 map04624 map04722 map05133 map05140 map05142 map05145 map05152 map05162 map05164

Pfam Domains

Protein Families

Pkinase Pkinase_Tyr

Protein Analysis

135

Amino Acids

15.33

Weight (kDa)

5.08

Isoelectric Point (pI)

58.54

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019339)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0353941 RchiOBHm_Chr4g0399951 RchiOBHm_Chr7g0205211
rosa_laevigata	RLG00000003393
rosa_multiflora	Rmu_sc0001072.1_g000010 Rmu_sc0009349.1_g000005
rosa_samantha	Rh1BG222300 Rh1DG249000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	38
AclWI	GGATC	2 cut(s)	183, 378
AcuI	CTGAAG	1 cut(s)	50
AfaI	GTAC	1 cut(s)	252
AfiI	CCNNNNNNNGG	3 cut(s)	28, 140, 310
AgsI	TTSAA	1 cut(s)	58
AjnI	CCWGG	1 cut(s)	21
AluBI	AGCT	4 cut(s)	34, 53, 124, 172
AluI	AGCT	4 cut(s)	34, 53, 124, 172
Alw26I	GTCTC	1 cut(s)	219
AlwI	GGATC	2 cut(s)	183, 378
AoxI	GGCC	1 cut(s)	92
AspS9I	GGNCC	3 cut(s)	19, 93, 301
AsuHPI	GGTGA	2 cut(s)	161, 271
AvaII	GGWCC	2 cut(s)	19, 301
BciT130I	CCWGG	1 cut(s)	23
BcoDI	GTCTC	1 cut(s)	219
BfmI	CTRYAG	1 cut(s)	306
Bme1390I	CCNGG	1 cut(s)	23
Bme18I	GGWCC	2 cut(s)	19, 301
BmgT120I	GGNCC	3 cut(s)	19, 93, 301
BmiI	GGNNCC	3 cut(s)	20, 95, 303
BmrFI	CCNGG	1 cut(s)	23
BmsI	GCATC	2 cut(s)	203, 325
BpmI	CTGGAG	1 cut(s)	275
BpuEI	CTTGAG	1 cut(s)	101
Bsc4I	CCNNNNNNNGG	3 cut(s)	28, 140, 310
Bse1I	ACTGG	2 cut(s)	46, 258
BseBI	CCWGG	1 cut(s)	23
BseGI	GGATG	2 cut(s)	226, 340
BseLI	CCNNNNNNNGG	3 cut(s)	28, 140, 310
BseMII	CTCAG	1 cut(s)	356
BseNI	ACTGG	2 cut(s)	46, 258
BshFI	GGCC	1 cut(s)	94
BslFI	GGGAC	1 cut(s)	287
BslI	CCNNNNNNNGG	3 cut(s)	28, 140, 310
BsmAI	GTCTC	1 cut(s)	219
BsmFI	GGGAC	1 cut(s)	287
BsnI	GGCC	1 cut(s)	94
Bsp143I	GATC	2 cut(s)	175, 370
BspANI	GGCC	1 cut(s)	94
BspCNI	CTCAG	1 cut(s)	357
BspHI	TCATGA	1 cut(s)	234
BspLI	GGNNCC	3 cut(s)	20, 95, 303
BspMAI	CTGCAG	1 cut(s)	310
BspPI	GGATC	2 cut(s)	183, 378
BsrI	ACTGG	2 cut(s)	46, 258
BssMI	GATC	2 cut(s)	175, 370
Bst2UI	CCWGG	1 cut(s)	23
Bst4CI	ACNGT	1 cut(s)	213
BstDEI	CTNAG	2 cut(s)	320, 365
BstF5I	GGATG	2 cut(s)	226, 340
BstKTI	GATC	2 cut(s)	178, 373
BstMAI	GTCTC	1 cut(s)	219
BstMBI	GATC	2 cut(s)	175, 370
BstNI	CCWGG	1 cut(s)	23
BstSCI	CCNGG	1 cut(s)	21
BstSFI	CTRYAG	1 cut(s)	306
BstX2I	RGATCY	1 cut(s)	370
BstYI	RGATCY	1 cut(s)	370
BsuRI	GGCC	1 cut(s)	94
BtsCI	GGATG	2 cut(s)	226, 340
CciI	TCATGA	1 cut(s)	234
Cfr13I	GGNCC	3 cut(s)	19, 93, 301
Csp6I	GTAC	1 cut(s)	251
CviAII	CATG	1 cut(s)	235
CviJI	RGCY	8 cut(s)	26, 34, 53, 75, 94, 124, 172, 402
CviKI_1	RGCY	8 cut(s)	26, 34, 53, 75, 94, 124, 172, 402
CviQI	GTAC	1 cut(s)	251
DdeI	CTNAG	2 cut(s)	320, 365
DpnI	GATC	2 cut(s)	177, 372
DpnII	GATC	2 cut(s)	175, 370
Eco47I	GGWCC	2 cut(s)	19, 301
Eco57I	CTGAAG	1 cut(s)	50
EcoO109I	RGGNCCY	3 cut(s)	19, 93, 301
EcoRII	CCWGG	1 cut(s)	21
EcoT22I	ATGCAT	1 cut(s)	206
FaeI	CATG	1 cut(s)	238
FaqI	GGGAC	1 cut(s)	287
FatI	CATG	1 cut(s)	234
FauNDI	CATATG	1 cut(s)	180
FokI	GGATG	2 cut(s)	213, 347
GsuI	CTGGAG	1 cut(s)	275
HaeIII	GGCC	1 cut(s)	94
Hin1II	CATG	1 cut(s)	238
HinfI	GANTC	1 cut(s)	238
HphI	GGTGA	2 cut(s)	161, 271
Hpy166II	GTNNAC	1 cut(s)	189
Hpy188I	TCNGA	1 cut(s)	366
Hpy188III	TCNNGA	2 cut(s)	235, 405
Hpy8I	GTNNAC	1 cut(s)	189
HpyCH4III	ACNGT	1 cut(s)	213
HpyCH4V	TGCA	4 cut(s)	194, 204, 308, 338
HpyF3I	CTNAG	2 cut(s)	320, 365
Hsp92II	CATG	1 cut(s)	238
Kzo9I	GATC	2 cut(s)	175, 370
LmnI	GCTCC	2 cut(s)	31, 121
LpnPI	CCDG	9 cut(s)	8, 27, 35, 63, 110, 158, 227, 239, 318
LweI	GCATC	2 cut(s)	203, 325
MaeIII	GTNAC	2 cut(s)	149, 259
MalI	GATC	2 cut(s)	177, 372
MboI	GATC	2 cut(s)	175, 370
MboII	GAAGA	2 cut(s)	56, 336
MflI	RGATCY	1 cut(s)	370
MluCI	AATT	1 cut(s)	58
MlyI	GAGTC	1 cut(s)	247
MmeI	TCCRAC	1 cut(s)	312
MnlI	CCTC	7 cut(s)	125, 240, 241, 250, 292, 304, 360
Mph1103I	ATGCAT	1 cut(s)	206
MseI	TTAA	2 cut(s)	102, 129
MslI	CAYNNNNRTG	1 cut(s)	199
MspR9I	CCNGG	1 cut(s)	23
MvaI	CCWGG	1 cut(s)	23
NdeI	CATATG	1 cut(s)	180
NdeII	GATC	2 cut(s)	175, 370
NlaIII	CATG	1 cut(s)	238
NlaIV	GGNNCC	3 cut(s)	20, 95, 303
NmuCI	GTSAC	2 cut(s)	149, 259
NsiI	ATGCAT	1 cut(s)	206
PagI	TCATGA	1 cut(s)	234
PleI	GAGTC	1 cut(s)	246
PpsI	GAGTC	1 cut(s)	246
PpuMI	RGGWCCY	2 cut(s)	19, 301
PsiI	TTATAA	1 cut(s)	38
Psp5II	RGGWCCY	2 cut(s)	19, 301
Psp6I	CCWGG	1 cut(s)	21
PspGI	CCWGG	1 cut(s)	21
PspN4I	GGNNCC	3 cut(s)	20, 95, 303
PspPI	GGNCC	3 cut(s)	19, 93, 301
PspPPI	RGGWCCY	2 cut(s)	19, 301
PstI	CTGCAG	1 cut(s)	310
PsuI	RGATCY	1 cut(s)	370
RsaI	GTAC	1 cut(s)	252
RsaNI	GTAC	1 cut(s)	251
RseI	CAYNNNNRTG	1 cut(s)	199
SaqAI	TTAA	2 cut(s)	102, 129
Sau3AI	GATC	2 cut(s)	175, 370
Sau96I	GGNCC	3 cut(s)	19, 93, 301
SchI	GAGTC	1 cut(s)	247
ScrFI	CCNGG	1 cut(s)	23
SetI	ASST	9 cut(s)	36, 55, 117, 126, 174, 246, 252, 261, 303
SfaNI	GCATC	2 cut(s)	203, 325
SfcI	CTRYAG	1 cut(s)	306
SinI	GGWCC	2 cut(s)	19, 301
SmiMI	CAYNNNNRTG	1 cut(s)	199
SmlI	CTYRAG	1 cut(s)	116
SmoI	CTYRAG	1 cut(s)	116
Sse9I	AATT	1 cut(s)	58
StyD4I	CCNGG	1 cut(s)	21
TaaI	ACNGT	1 cut(s)	213
TasI	AATT	1 cut(s)	58
Tru1I	TTAA	2 cut(s)	102, 129
Tru9I	TTAA	2 cut(s)	102, 129
TseFI	GTSAC	2 cut(s)	149, 259
Tsp45I	GTSAC	2 cut(s)	149, 259
TspDTI	ATGAA	1 cut(s)	306
VpaK11BI	GGWCC	2 cut(s)	19, 301
Zsp2I	ATGCAT	1 cut(s)	206

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.