Rmu_sc0009349.1_g000005
ERF Family

belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009349.1
Physical Location & Seq
Forward (+)
16926 .. 18753
1828 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009349.1_g000005.1.cds

Sequence Viewer

Length: 486 bp
atggaatataagatgaaaaatctgatgtgtattcttttgggggtcctagctttggagcttataactggtcttccagctttgaattatcttcagcaaagccttgttatttgggcaaggcccctgcttaaagcaaacgacctcaaggagcttgttaatccttatattggtattggtgacaactatgacagcacagagctggatcatatggtgtggactgcatctttatgcatagaacagtctcctattctacatcccctcatgagtcaggttgaggtactggaggtgacgagtgcaaagtttctcattaccgttggcttagatgatgatgatcaacgcattgaggttgattttgcagcttggttaatattgcagttcagaaagagcctcataagcctgagtcccatcggtcatgtatacatgtggaatttgacatctttgcaactggtatcaggtaagtttatgactttaacaactgcttttgtctaa

Protein Analysis

161

Amino Acids

18.19

Weight (kDa)

4.76

Isoelectric Point (pI)

47.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019339)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 62
AccI GTMKAC 1 cut(s) 414
AclWI GGATC 1 cut(s) 207
AcsI RAATTY 1 cut(s) 424
AcuI CTGAAG 1 cut(s) 74
AfaI GTAC 1 cut(s) 276
AfiI CCNNNNNNNGG 2 cut(s) 52, 164
AflIII ACRYGT 1 cut(s) 417
AgsI TTSAA 1 cut(s) 82
AluBI AGCT 6 cut(s) 50, 58, 77, 148, 196, 356
AluI AGCT 6 cut(s) 50, 58, 77, 148, 196, 356
Alw26I GTCTC 1 cut(s) 243
AlwI GGATC 1 cut(s) 207
AoxI GGCC 1 cut(s) 116
ApeKI GCWGC 1 cut(s) 353
ApoI RAATTY 1 cut(s) 424
AspS9I GGNCC 2 cut(s) 43, 117
AsuHPI GGTGA 2 cut(s) 185, 295
AvaII GGWCC 1 cut(s) 43
BbsI GAAGAC 1 cut(s) 62
BbvI GCAGC 1 cut(s) 365
BccI CCATC 1 cut(s) 410
BclI TGATCA 1 cut(s) 328
BcoDI GTCTC 1 cut(s) 243
BfaI CTAG 1 cut(s) 47
BisI GCNGC 1 cut(s) 354
BlsI GCNGC 1 cut(s) 355
Bme18I GGWCC 1 cut(s) 43
BmgT120I GGNCC 2 cut(s) 43, 117
BmiI GGNNCC 2 cut(s) 44, 119
BmsI GCATC 1 cut(s) 227
BpiI GAAGAC 1 cut(s) 62
BpmI CTGGAG 1 cut(s) 299
BpuEI CTTGAG 1 cut(s) 125
BsaBI GATNNNNATC 1 cut(s) 327
Bsc4I CCNNNNNNNGG 2 cut(s) 52, 164
Bse1I ACTGG 3 cut(s) 70, 282, 447
Bse8I GATNNNNATC 1 cut(s) 327
BseGI GGATG 1 cut(s) 250
BseJI GATNNNNATC 1 cut(s) 327
BseLI CCNNNNNNNGG 2 cut(s) 52, 164
BseMII CTCAG 1 cut(s) 386
BseNI ACTGG 3 cut(s) 70, 282, 447
BseXI GCAGC 1 cut(s) 365
BshFI GGCC 1 cut(s) 118
BslFI GGGAC 1 cut(s) 384
BslI CCNNNNNNNGG 2 cut(s) 52, 164
BsmAI GTCTC 1 cut(s) 243
BsmFI GGGAC 1 cut(s) 384
BsnI GGCC 1 cut(s) 118
Bsp143I GATC 2 cut(s) 199, 328
BspANI GGCC 1 cut(s) 118
BspCNI CTCAG 1 cut(s) 387
BspHI TCATGA 1 cut(s) 258
BspLI GGNNCC 2 cut(s) 44, 119
BspPI GGATC 1 cut(s) 207
BsrI ACTGG 3 cut(s) 70, 282, 447
BssMI GATC 2 cut(s) 199, 328
BssNAI GTATAC 1 cut(s) 415
Bst1107I GTATAC 1 cut(s) 415
Bst4CI ACNGT 2 cut(s) 237, 310
BstDEI CTNAG 2 cut(s) 316, 395
BstF5I GGATG 1 cut(s) 250
BstKTI GATC 2 cut(s) 202, 331
BstMAI GTCTC 1 cut(s) 243
BstMBI GATC 2 cut(s) 199, 328
BstMWI GCNNNNNNNGC 1 cut(s) 390
BstNSI RCATGY 1 cut(s) 421
BstV1I GCAGC 1 cut(s) 365
BstV2I GAAGAC 1 cut(s) 62
BstZ17I GTATAC 1 cut(s) 415
BsuRI GGCC 1 cut(s) 118
BtsCI GGATG 1 cut(s) 250
CciI TCATGA 1 cut(s) 258
Cfr13I GGNCC 2 cut(s) 43, 117
Csp6I GTAC 1 cut(s) 275
CviAII CATG 3 cut(s) 259, 410, 418
CviQI GTAC 1 cut(s) 275
DdeI CTNAG 2 cut(s) 316, 395
DpnI GATC 2 cut(s) 201, 330
DpnII GATC 2 cut(s) 199, 328
Eco47I GGWCC 1 cut(s) 43
Eco57I CTGAAG 1 cut(s) 74
EcoO109I RGGNCCY 2 cut(s) 43, 117
EcoT22I ATGCAT 1 cut(s) 230
FaeI CATG 3 cut(s) 262, 413, 421
FaqI GGGAC 1 cut(s) 384
FatI CATG 3 cut(s) 258, 409, 417
FauNDI CATATG 1 cut(s) 204
FbaI TGATCA 1 cut(s) 328
FblI GTMKAC 1 cut(s) 414
Fnu4HI GCNGC 1 cut(s) 354
FokI GGATG 1 cut(s) 237
Fsp4HI GCNGC 1 cut(s) 354
FspBI CTAG 1 cut(s) 47
GluI GCNGC 1 cut(s) 354
GsuI CTGGAG 1 cut(s) 299
HaeIII GGCC 1 cut(s) 118
Hin1II CATG 3 cut(s) 262, 413, 421
HinfI GANTC 2 cut(s) 262, 397
HphI GGTGA 2 cut(s) 185, 295
Hpy166II GTNNAC 2 cut(s) 213, 415
Hpy188I TCNGA 2 cut(s) 24, 377
Hpy188III TCNNGA 1 cut(s) 259
Hpy8I GTNNAC 2 cut(s) 213, 415
HpyCH4III ACNGT 2 cut(s) 237, 310
HpyCH4V TGCA 6 cut(s) 218, 228, 293, 353, 370, 439
HpyF10VI GCNNNNNNNGC 1 cut(s) 390
HpyF3I CTNAG 2 cut(s) 316, 395
Hsp92II CATG 3 cut(s) 262, 413, 421
Ksp22I TGATCA 1 cut(s) 328
Kzo9I GATC 2 cut(s) 199, 328
LmnI GCTCC 2 cut(s) 55, 145
LpnPI CCDG 9 cut(s) 51, 87, 134, 182, 251, 263, 407, 428, 435
Lsp1109I GCAGC 1 cut(s) 365
LweI GCATC 1 cut(s) 227
MaeI CTAG 1 cut(s) 47
MaeIII GTNAC 2 cut(s) 173, 283
MalI GATC 2 cut(s) 201, 330
MboI GATC 2 cut(s) 199, 328
MboII GAAGA 2 cut(s) 62, 80
MluCI AATT 2 cut(s) 82, 424
MlyI GAGTC 2 cut(s) 271, 406
MnlI CCTC 6 cut(s) 149, 265, 266, 274, 334, 395
Mph1103I ATGCAT 1 cut(s) 230
MseI TTAA 4 cut(s) 126, 153, 362, 467
MslI CAYNNNNRTG 1 cut(s) 223
MwoI GCNNNNNNNGC 1 cut(s) 390
NdeI CATATG 1 cut(s) 204
NdeII GATC 2 cut(s) 199, 328
NlaIII CATG 3 cut(s) 262, 413, 421
NlaIV GGNNCC 2 cut(s) 44, 119
NmuCI GTSAC 2 cut(s) 173, 283
NsiI ATGCAT 1 cut(s) 230
NspI RCATGY 1 cut(s) 421
PagI TCATGA 1 cut(s) 258
PciI ACATGT 1 cut(s) 417
PkrI GCNGC 1 cut(s) 355
PleI GAGTC 2 cut(s) 270, 405
PpsI GAGTC 2 cut(s) 270, 405
PpuMI RGGWCCY 1 cut(s) 43
PscI ACATGT 1 cut(s) 417
PsiI TTATAA 1 cut(s) 62
Psp5II RGGWCCY 1 cut(s) 43
PspN4I GGNNCC 2 cut(s) 44, 119
PspPI GGNCC 2 cut(s) 43, 117
PspPPI RGGWCCY 1 cut(s) 43
RsaI GTAC 1 cut(s) 276
RsaNI GTAC 1 cut(s) 275
RseI CAYNNNNRTG 1 cut(s) 223
SaqAI TTAA 4 cut(s) 126, 153, 362, 467
SatI GCNGC 1 cut(s) 354
Sau3AI GATC 2 cut(s) 199, 328
Sau96I GGNCC 2 cut(s) 43, 117
SchI GAGTC 2 cut(s) 271, 406
SfaNI GCATC 1 cut(s) 227
SinI GGWCC 1 cut(s) 43
SmiMI CAYNNNNRTG 1 cut(s) 223
SmlI CTYRAG 1 cut(s) 140
SmoI CTYRAG 1 cut(s) 140
Sse9I AATT 2 cut(s) 82, 424
SspI AATATT 1 cut(s) 366
SspMI CTAG 1 cut(s) 47
TaaI ACNGT 2 cut(s) 237, 310
TaqII GACCGA 1 cut(s) 395
TasI AATT 2 cut(s) 82, 424
Tru1I TTAA 4 cut(s) 126, 153, 362, 467
Tru9I TTAA 4 cut(s) 126, 153, 362, 467
TseFI GTSAC 2 cut(s) 173, 283
TseI GCWGC 1 cut(s) 353
Tsp45I GTSAC 2 cut(s) 173, 283
TspDTI ATGAA 1 cut(s) 29
VpaK11BI GGWCC 1 cut(s) 43
XapI RAATTY 1 cut(s) 424
XceI RCATGY 1 cut(s) 421
XmiI GTMKAC 1 cut(s) 414
XspI CTAG 1 cut(s) 47
Zsp2I ATGCAT 1 cut(s) 230
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.