Rmu_sc0001211.1_g000125

Domain of unknown function (DUF4283)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001211.1
OG0021052
Physical Location & Seq
Reverse (-)
501994 .. 505382
3389 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001211.1_g000125.1.cds

Sequence Viewer

Length: 828 bp
atggatgacgttgcggcctctttggcccttgcaacaaatgaggtcgtggatctctcaggatcggccaactctgtagaatgccgaggaaagaaatcttatctactcgctcgccctcttgcagccaaaccagccccattgcaggaccttcgacgaccatggcatttcaaccaagccccgattgtgctgcaagagtatgataggattgctccgccgcactcggtggccttgaatactttatttttctgggtacttattacgagtataccactaccctttgaggacaaagacactattagagatgttgctacgattgcgggcaaagtcatggagttagatgataaactctttgacaatactggcaagataagggttaagggccgggctcttccccgtacggaaccaaaccttgtacaacggaaattggagatcacaggtccctctctgagttttatgcaaagccattttgagaatggcatgttcaagttccaacggctccaaacccctatcttaccatcggtgacacgctctctttttcactcaaaagagaagggtgctcgaaagcctgtggtgttgagaggatcagattttagatcaacctctagtagggatgaggaggataccaccttggcattggtcccgaggatgccagagggaggatcgcatggtggagacgagctgatctggagagtttcaccgccggatgccgccagagtttgcaggaaaagtcaggttgggtggggtcagtcgggtttattcgatactgaaggtgcagccgagagagaagagagagagaaggaaagtttccggaaaaggaaaatggaattatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_3 zf-CCHC_4

Protein Analysis

275

Amino Acids

30.82

Weight (kDa)

9.05

Isoelectric Point (pI)

42.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021052)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g33131
rosa_multiflora Rmu_sc0000903.1_g000032 Rmu_sc0001211.1_g000125 Rmu_sc0003846.1_g000007 Rmu_sc0007066.1_g000010

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 262
AccIII TCCGGA 1 cut(s) 804
AciI CCGC 6 cut(s) 14, 209, 212, 314, 695, 705
AclWI GGATC 4 cut(s) 57, 67, 586, 664
AcoI YGGCCR 1 cut(s) 63
AcuI CTGAAG 1 cut(s) 783
AdeI CACNNNGTG 1 cut(s) 220
AfaI GTAC 3 cut(s) 249, 394, 411
AfiI CCNNNNNNNGG 3 cut(s) 139, 603, 653
AgsI TTSAA 3 cut(s) 166, 229, 481
AluBI AGCT 1 cut(s) 676
AluI AGCT 1 cut(s) 676
Alw21I GWGCWC 1 cut(s) 556
Alw26I GTCTC 1 cut(s) 663
AlwI GGATC 4 cut(s) 57, 67, 586, 664
Ama87I CYCGRG 1 cut(s) 637
Aor13HI TCCGGA 1 cut(s) 804
AoxI GGCC 5 cut(s) 15, 24, 63, 222, 376
ApeKI GCWGC 3 cut(s) 119, 184, 770
AspS9I GGNCC 5 cut(s) 25, 142, 376, 434, 634
AsuC2I CCSGG 1 cut(s) 380
AsuHPI GGTGA 2 cut(s) 529, 684
AvaI CYCGRG 1 cut(s) 637
AvaII GGWCC 3 cut(s) 142, 434, 634
BanII GRGCYC 1 cut(s) 385
Bbv12I GWGCWC 1 cut(s) 556
BbvI GCAGC 3 cut(s) 131, 171, 782
BccI CCATC 1 cut(s) 520
BceAI ACGGC 1 cut(s) 506
BcgI CGANNNNNNTGC 4 cut(s) 128, 162, 166, 200
BciVI GTATCC 1 cut(s) 610
BcnI CCSGG 1 cut(s) 380
BcoDI GTCTC 1 cut(s) 663
BfaI CTAG 1 cut(s) 600
BfmI CTRYAG 1 cut(s) 72
BfuI GTATCC 1 cut(s) 610
BglI GCCNNNNNGGC 1 cut(s) 23
BisI GCNGC 6 cut(s) 15, 120, 185, 212, 705, 771
BlsI GCNGC 6 cut(s) 16, 121, 186, 213, 706, 772
Bme1390I CCNGG 1 cut(s) 380
Bme18I GGWCC 3 cut(s) 142, 434, 634
BmeT110I CYCGRG 1 cut(s) 637
BmgT120I GGNCC 5 cut(s) 25, 142, 376, 434, 634
BmiI GGNNCC 4 cut(s) 399, 436, 494, 636
BmrFI CCNGG 1 cut(s) 380
BmsI GCATC 2 cut(s) 633, 691
BpmI CTGGAG 1 cut(s) 703
BpuMI CCSGG 1 cut(s) 380
BsaJI CCNNGG 4 cut(s) 82, 155, 624, 638
BsaWI WCCGGW 1 cut(s) 804
Bsc4I CCNNNNNNNGG 3 cut(s) 139, 603, 653
Bse1I ACTGG 1 cut(s) 361
Bse3DI GCAATG 1 cut(s) 134
BseAI TCCGGA 1 cut(s) 804
BseDI CCNNGG 4 cut(s) 82, 155, 624, 638
BseGI GGATG 4 cut(s) 10, 613, 648, 706
BseLI CCNNNNNNNGG 3 cut(s) 139, 603, 653
BseMI GCAATG 1 cut(s) 134
BseMII CTCAG 2 cut(s) 69, 434
BseNI ACTGG 1 cut(s) 361
BseRI GAGGAG 1 cut(s) 626
BseXI GCAGC 3 cut(s) 131, 171, 782
BsgI GTGCAG 1 cut(s) 789
BshFI GGCC 5 cut(s) 17, 26, 65, 224, 378
BsiHKAI GWGCWC 1 cut(s) 556
BsiHKCI CYCGRG 1 cut(s) 637
BsiSI CCGG 3 cut(s) 379, 698, 805
BsiWI CGTACG 1 cut(s) 392
BslFI GGGAC 2 cut(s) 420, 620
BslI CCNNNNNNNGG 3 cut(s) 139, 603, 653
BsmAI GTCTC 1 cut(s) 663
BsmBI CGTCTC 1 cut(s) 663
BsmFI GGGAC 2 cut(s) 420, 620
BsmI GAATGC 1 cut(s) 83
BsnI GGCC 5 cut(s) 17, 26, 65, 224, 378
BsoBI CYCGRG 1 cut(s) 637
Bsp1286I GDGCHC 2 cut(s) 385, 556
Bsp13I TCCGGA 1 cut(s) 804
Bsp1407I TGTACA 1 cut(s) 409
Bsp143I GATC 7 cut(s) 49, 59, 426, 578, 590, 656, 678
Bsp19I CCATGG 1 cut(s) 155
BspACI CCGC 6 cut(s) 14, 209, 212, 314, 695, 705
BspANI GGCC 5 cut(s) 17, 26, 65, 224, 378
BspCNI CTCAG 2 cut(s) 68, 435
BspEI TCCGGA 1 cut(s) 804
BspLI GGNNCC 4 cut(s) 399, 436, 494, 636
BspPI GGATC 4 cut(s) 57, 67, 586, 664
BspQI GCTCTTC 1 cut(s) 390
BsrDI GCAATG 1 cut(s) 134
BsrGI TGTACA 1 cut(s) 409
BsrI ACTGG 1 cut(s) 361
BssECI CCNNGG 4 cut(s) 82, 155, 624, 638
BssMI GATC 7 cut(s) 49, 59, 426, 578, 590, 656, 678
BssNAI GTATAC 1 cut(s) 263
BssT1I CCWWGG 2 cut(s) 155, 624
Bst1107I GTATAC 1 cut(s) 263
Bst6I CTCTTC 2 cut(s) 390, 777
BstAUI TGTACA 1 cut(s) 409
BstC8I GCNNGC 2 cut(s) 109, 316
BstDEI CTNAG 2 cut(s) 55, 443
BstDSI CCRYGG 1 cut(s) 155
BstENI CCTNNNNNAGG 1 cut(s) 601
BstF5I GGATG 4 cut(s) 10, 613, 648, 706
BstKTI GATC 7 cut(s) 52, 62, 429, 581, 593, 659, 681
BstMAI GTCTC 1 cut(s) 663
BstMBI GATC 7 cut(s) 49, 59, 426, 578, 590, 656, 678
BstMWI GCNNNNNNNGC 3 cut(s) 23, 128, 311
BstNSI RCATGY 1 cut(s) 478
BstSCI CCNGG 1 cut(s) 378
BstSFI CTRYAG 1 cut(s) 72
BstV1I GCAGC 3 cut(s) 131, 171, 782
BstX2I RGATCY 1 cut(s) 49
BstYI RGATCY 1 cut(s) 49
BstZ17I GTATAC 1 cut(s) 263
BsuI GTATCC 1 cut(s) 610
BsuRI GGCC 5 cut(s) 17, 26, 65, 224, 378
BtgI CCRYGG 1 cut(s) 155
BtsCI GGATG 4 cut(s) 10, 613, 648, 706
Cac8I GCNNGC 2 cut(s) 109, 316
Cfr13I GGNCC 5 cut(s) 25, 142, 376, 434, 634
Csp6I GTAC 3 cut(s) 248, 393, 410
CviAII CATG 4 cut(s) 156, 325, 475, 662
CviQI GTAC 3 cut(s) 248, 393, 410
DdeI CTNAG 2 cut(s) 55, 443
DpnI GATC 7 cut(s) 51, 61, 428, 580, 592, 658, 680
DpnII GATC 7 cut(s) 49, 59, 426, 578, 590, 656, 678
DraIII CACNNNGTG 1 cut(s) 220
EaeI YGGCCR 1 cut(s) 63
Eam1104I CTCTTC 2 cut(s) 390, 777
EarI CTCTTC 2 cut(s) 390, 777
EciI GGCGGA 1 cut(s) 198
Eco130I CCWWGG 2 cut(s) 155, 624
Eco24I GRGCYC 1 cut(s) 385
Eco47I GGWCC 3 cut(s) 142, 434, 634
Eco57I CTGAAG 1 cut(s) 783
Eco88I CYCGRG 1 cut(s) 637
EcoNI CCTNNNNNAGG 1 cut(s) 601
EcoO109I RGGNCCY 2 cut(s) 142, 434
EcoT14I CCWWGG 2 cut(s) 155, 624
EcoT38I GRGCYC 1 cut(s) 385
ErhI CCWWGG 2 cut(s) 155, 624
Esp3I CGTCTC 1 cut(s) 663
FaeI CATG 4 cut(s) 159, 328, 478, 665
FaiI YATR 8 cut(s) 157, 195, 263, 326, 452, 476, 663, 826
FaqI GGGAC 2 cut(s) 420, 620
FatI CATG 4 cut(s) 155, 324, 474, 661
FauI CCCGC 1 cut(s) 307
FblI GTMKAC 1 cut(s) 262
Fnu4HI GCNGC 6 cut(s) 15, 120, 185, 212, 705, 771
FokI GGATG 4 cut(s) 17, 620, 655, 713
FriOI GRGCYC 1 cut(s) 385
Fsp4HI GCNGC 6 cut(s) 15, 120, 185, 212, 705, 771
FspBI CTAG 1 cut(s) 600
GluI GCNGC 6 cut(s) 15, 120, 185, 212, 705, 771
GsuI CTGGAG 1 cut(s) 703
HaeIII GGCC 5 cut(s) 17, 26, 65, 224, 378
HapII CCGG 3 cut(s) 379, 698, 805
Hin1II CATG 4 cut(s) 159, 328, 478, 665
HpaII CCGG 3 cut(s) 379, 698, 805
HphI GGTGA 2 cut(s) 529, 684
Hpy166II GTNNAC 1 cut(s) 263
Hpy188I TCNGA 2 cut(s) 444, 583
Hpy188III TCNNGA 4 cut(s) 57, 637, 682, 805
Hpy8I GTNNAC 1 cut(s) 263
Hpy99I CGWCG 1 cut(s) 153
HpyAV CCTTC 4 cut(s) 155, 541, 758, 787
HpyCH4IV ACGT 1 cut(s) 9
HpyCH4V TGCA 7 cut(s) 32, 119, 139, 187, 454, 717, 770
HpyF10VI GCNNNNNNNGC 3 cut(s) 23, 128, 311
HpyF3I CTNAG 2 cut(s) 55, 443
HpySE526I ACGT 1 cut(s) 9
Hsp92II CATG 4 cut(s) 159, 328, 478, 665
Kpn2I TCCGGA 1 cut(s) 804
Kzo9I GATC 7 cut(s) 49, 59, 426, 578, 590, 656, 678
LguI GCTCTTC 1 cut(s) 390
LmnI GCTCC 2 cut(s) 211, 498
Lsp1109I GCAGC 3 cut(s) 131, 171, 782
LweI GCATC 2 cut(s) 633, 691
MaeI CTAG 1 cut(s) 600
MaeII ACGT 1 cut(s) 9
MaeIII GTNAC 1 cut(s) 517
MalI GATC 7 cut(s) 51, 61, 428, 580, 592, 658, 680
MboI GATC 7 cut(s) 49, 59, 426, 578, 590, 656, 678
MboII GAAGA 2 cut(s) 377, 794
MflI RGATCY 1 cut(s) 49
MhlI GDGCHC 2 cut(s) 385, 556
MluCI AATT 2 cut(s) 419, 821
MmeI TCCRAC 1 cut(s) 511
MroI TCCGGA 1 cut(s) 804
MseI TTAA 1 cut(s) 372
MspI CCGG 3 cut(s) 379, 698, 805
MspR9I CCNGG 1 cut(s) 380
Mva1269I GAATGC 1 cut(s) 83
MwoI GCNNNNNNNGC 3 cut(s) 23, 128, 311
NciI CCSGG 1 cut(s) 380
NcoI CCATGG 1 cut(s) 155
NdeII GATC 7 cut(s) 49, 59, 426, 578, 590, 656, 678
NlaIII CATG 4 cut(s) 159, 328, 478, 665
NlaIV GGNNCC 4 cut(s) 399, 436, 494, 636
NmeAIII GCCGAG 2 cut(s) 107, 799
NmuCI GTSAC 1 cut(s) 517
NspI RCATGY 1 cut(s) 478
PciSI GCTCTTC 1 cut(s) 390
PctI GAATGC 1 cut(s) 83
Pfl23II CGTACG 1 cut(s) 392
PkrI GCNGC 6 cut(s) 16, 121, 186, 213, 706, 772
PpuMI RGGWCCY 2 cut(s) 142, 434
Psp5II RGGWCCY 2 cut(s) 142, 434
PspLI CGTACG 1 cut(s) 392
PspN4I GGNNCC 4 cut(s) 399, 436, 494, 636
PspPI GGNCC 5 cut(s) 25, 142, 376, 434, 634
PspPPI RGGWCCY 2 cut(s) 142, 434
PsuI RGATCY 1 cut(s) 49
RsaI GTAC 3 cut(s) 249, 394, 411
RsaNI GTAC 3 cut(s) 248, 393, 410
SapI GCTCTTC 1 cut(s) 390
SaqAI TTAA 1 cut(s) 372
SatI GCNGC 6 cut(s) 15, 120, 185, 212, 705, 771
Sau3AI GATC 7 cut(s) 49, 59, 426, 578, 590, 656, 678
Sau96I GGNCC 5 cut(s) 25, 142, 376, 434, 634
ScrFI CCNGG 1 cut(s) 380
SduI GDGCHC 2 cut(s) 385, 556
SfaNI GCATC 2 cut(s) 633, 691
SfcI CTRYAG 1 cut(s) 72
SfiI GGCCNNNNNGGCC 1 cut(s) 23
SinI GGWCC 3 cut(s) 142, 434, 634
Sse9I AATT 2 cut(s) 419, 821
SsiI CCGC 6 cut(s) 14, 209, 212, 314, 695, 705
SspMI CTAG 1 cut(s) 600
StyD4I CCNGG 1 cut(s) 378
StyI CCWWGG 2 cut(s) 155, 624
TaiI ACGT 1 cut(s) 12
TaqI TCGA 3 cut(s) 148, 556, 756
TasI AATT 2 cut(s) 419, 821
TatI WGTACW 1 cut(s) 409
TauI GCSGC 3 cut(s) 17, 214, 707
Tru1I TTAA 1 cut(s) 372
Tru9I TTAA 1 cut(s) 372
TseFI GTSAC 1 cut(s) 517
TseI GCWGC 3 cut(s) 119, 184, 770
Tsp45I GTSAC 1 cut(s) 517
TspGWI ACGGA 2 cut(s) 410, 430
VpaK11BI GGWCC 3 cut(s) 142, 434, 634
XagI CCTNNNNNAGG 1 cut(s) 601
XceI RCATGY 1 cut(s) 478
XcmI CCANNNNNNNNNTGG 2 cut(s) 467, 628
XmiI GTMKAC 1 cut(s) 262
XspI CTAG 1 cut(s) 600
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.