Rmu_sc0003846.1_g000007

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003846.1
OG0021052
Physical Location & Seq
Reverse (-)
16183 .. 16889
707 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003846.1_g000007.1.cds

Sequence Viewer

Length: 498 bp
atgctcactacagatctcatgaagtcatcgacatctccagaagagctgggggatctcaacgtcgagcaaaaaggattcaaaatccaggaacacgcatacaatagttttgttttcgatctcctagaggatcaaaacaagattttgagcggtgaaccatggcggttctaccaagctccagttgtcctacaggaatatgacggcattacatctctacacactgtccgactgaactccctctatttttgggctcgtagaaccaatatccgaccattgtttaaggtacgtgacaccattgaagatgttgcttctgttactaggaaattcattgaactggatgaaaaacgttttgagaatctaggccaaggtaatgcaatttctgaaggagatcgttgttctgtgactgatggtagagttgtgttcagtgggatgaataatactgttgataagaggctagagattgccggtccatctttctgttcactaccaacaagtttgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

165

Amino Acids

18.8

Weight (kDa)

5.11

Isoelectric Point (pI)

43.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021052)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g33131
rosa_multiflora Rmu_sc0000903.1_g000032 Rmu_sc0001211.1_g000125 Rmu_sc0003846.1_g000007 Rmu_sc0007066.1_g000010

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 147
AciI CCGC 2 cut(s) 147, 160
AclI AACGTT 1 cut(s) 343
AclWI GGATC 2 cut(s) 60, 135
AcsI RAATTY 1 cut(s) 320
AcuI CTGAAG 1 cut(s) 399
AfaI GTAC 1 cut(s) 282
AgsI TTSAA 3 cut(s) 79, 296, 329
AjnI CCWGG 1 cut(s) 84
AluBI AGCT 2 cut(s) 46, 173
AluI AGCT 2 cut(s) 46, 173
AlwI GGATC 2 cut(s) 60, 135
AoxI GGCC 1 cut(s) 358
ApoI RAATTY 1 cut(s) 320
AspS9I GGNCC 1 cut(s) 464
AsuHPI GGTGA 1 cut(s) 161
AvaII GGWCC 1 cut(s) 464
BanII GRGCYC 1 cut(s) 250
BccI CCATC 2 cut(s) 398, 475
BceAI ACGGC 1 cut(s) 214
BciT130I CCWGG 1 cut(s) 86
BfaI CTAG 4 cut(s) 122, 315, 356, 452
BfmI CTRYAG 2 cut(s) 9, 185
BglII AGATCT 1 cut(s) 13
Bme1390I CCNGG 1 cut(s) 86
Bme18I GGWCC 1 cut(s) 464
BmgT120I GGNCC 1 cut(s) 464
BmrFI CCNGG 1 cut(s) 86
BpmI CTGGAG 2 cut(s) 21, 159
BsaAI YACGTR 1 cut(s) 284
BsaJI CCNNGG 2 cut(s) 155, 361
Bse118I RCCGGY 1 cut(s) 461
Bse1I ACTGG 2 cut(s) 176, 336
BseBI CCWGG 1 cut(s) 86
BseDI CCNNGG 2 cut(s) 155, 361
BseGI GGATG 2 cut(s) 340, 432
BseNI ACTGG 2 cut(s) 176, 336
BseYI CCCAGC 1 cut(s) 46
BshFI GGCC 1 cut(s) 360
BsiSI CCGG 1 cut(s) 462
BsnI GGCC 1 cut(s) 360
Bsp1286I GDGCHC 1 cut(s) 250
Bsp143I GATC 5 cut(s) 13, 52, 115, 127, 385
Bsp19I CCATGG 1 cut(s) 155
BspACI CCGC 2 cut(s) 147, 160
BspANI GGCC 1 cut(s) 360
BspHI TCATGA 1 cut(s) 18
BspPI GGATC 2 cut(s) 60, 135
BspQI GCTCTTC 1 cut(s) 36
BsrBI CCGCTC 1 cut(s) 147
BsrFI RCCGGY 1 cut(s) 461
BsrI ACTGG 2 cut(s) 176, 336
BssAI RCCGGY 1 cut(s) 461
BssECI CCNNGG 2 cut(s) 155, 361
BssMI GATC 5 cut(s) 13, 52, 115, 127, 385
BssT1I CCWWGG 2 cut(s) 155, 361
Bst2UI CCWGG 1 cut(s) 86
Bst4CI ACNGT 2 cut(s) 220, 439
Bst6I CTCTTC 1 cut(s) 36
BstBAI YACGTR 1 cut(s) 284
BstDSI CCRYGG 1 cut(s) 155
BstF5I GGATG 2 cut(s) 340, 432
BstKTI GATC 5 cut(s) 16, 55, 118, 130, 388
BstMBI GATC 5 cut(s) 13, 52, 115, 127, 385
BstNI CCWGG 1 cut(s) 86
BstSCI CCNGG 1 cut(s) 84
BstSFI CTRYAG 2 cut(s) 9, 185
BstX2I RGATCY 2 cut(s) 13, 52
BstYI RGATCY 2 cut(s) 13, 52
BsuRI GGCC 1 cut(s) 360
BtgI CCRYGG 1 cut(s) 155
BtsCI GGATG 2 cut(s) 340, 432
BtsIMutI CAGTG 2 cut(s) 216, 427
CciI TCATGA 1 cut(s) 18
Cfr10I RCCGGY 1 cut(s) 461
Cfr13I GGNCC 1 cut(s) 464
Csp6I GTAC 1 cut(s) 281
CviAII CATG 2 cut(s) 19, 156
CviJI RGCY 5 cut(s) 46, 173, 248, 360, 451
CviKI_1 RGCY 5 cut(s) 46, 173, 248, 360, 451
CviQI GTAC 1 cut(s) 281
DpnI GATC 5 cut(s) 15, 54, 117, 129, 387
DpnII GATC 5 cut(s) 13, 52, 115, 127, 385
Eam1104I CTCTTC 1 cut(s) 36
EarI CTCTTC 1 cut(s) 36
Eco130I CCWWGG 2 cut(s) 155, 361
Eco24I GRGCYC 1 cut(s) 250
Eco47I GGWCC 1 cut(s) 464
Eco57I CTGAAG 1 cut(s) 399
EcoRII CCWGG 1 cut(s) 84
EcoT14I CCWWGG 2 cut(s) 155, 361
EcoT38I GRGCYC 1 cut(s) 250
ErhI CCWWGG 2 cut(s) 155, 361
FaeI CATG 2 cut(s) 22, 159
FaiI YATR 4 cut(s) 20, 97, 157, 195
FatI CATG 2 cut(s) 18, 155
FokI GGATG 2 cut(s) 347, 439
FriOI GRGCYC 1 cut(s) 250
FspBI CTAG 4 cut(s) 122, 315, 356, 452
GsaI CCCAGC 1 cut(s) 50
GsuI CTGGAG 2 cut(s) 21, 159
HaeIII GGCC 1 cut(s) 360
HapII CCGG 1 cut(s) 462
Hin1II CATG 2 cut(s) 22, 159
HinfI GANTC 2 cut(s) 75, 352
HpaII CCGG 1 cut(s) 462
HphI GGTGA 1 cut(s) 161
Hpy166II GTNNAC 2 cut(s) 152, 479
Hpy188I TCNGA 3 cut(s) 224, 266, 379
Hpy188III TCNNGA 2 cut(s) 19, 38
Hpy8I GTNNAC 2 cut(s) 152, 479
Hpy99I CGWCG 1 cut(s) 65
HpyAV CCTTC 1 cut(s) 374
HpyCH4III ACNGT 2 cut(s) 220, 439
HpyCH4IV ACGT 3 cut(s) 60, 283, 343
HpyCH4V TGCA 1 cut(s) 371
HpySE526I ACGT 3 cut(s) 60, 283, 343
Hsp92II CATG 2 cut(s) 22, 159
Kzo9I GATC 5 cut(s) 13, 52, 115, 127, 385
LguI GCTCTTC 1 cut(s) 36
LmnI GCTCC 1 cut(s) 178
LpnPI CCDG 8 cut(s) 32, 51, 71, 98, 173, 189, 317, 475
MaeI CTAG 4 cut(s) 122, 315, 356, 452
MaeII ACGT 3 cut(s) 60, 283, 343
MaeIII GTNAC 3 cut(s) 284, 310, 397
MalI GATC 5 cut(s) 15, 54, 117, 129, 387
MbiI CCGCTC 1 cut(s) 147
MboI GATC 5 cut(s) 13, 52, 115, 127, 385
MboII GAAGA 2 cut(s) 53, 308
MflI RGATCY 2 cut(s) 13, 52
MhlI GDGCHC 1 cut(s) 250
MluCI AATT 2 cut(s) 320, 372
MmeI TCCRAC 2 cut(s) 247, 289
MnlI CCTC 3 cut(s) 118, 245, 441
MseI TTAA 1 cut(s) 276
MspI CCGG 1 cut(s) 462
MspR9I CCNGG 1 cut(s) 86
MvaI CCWGG 1 cut(s) 86
NcoI CCATGG 1 cut(s) 155
NdeII GATC 5 cut(s) 13, 52, 115, 127, 385
NlaIII CATG 2 cut(s) 22, 159
NmuCI GTSAC 2 cut(s) 284, 397
PagI TCATGA 1 cut(s) 18
PciSI GCTCTTC 1 cut(s) 36
PfeI GAWTC 2 cut(s) 75, 352
PfoI TCCNGGA 1 cut(s) 84
Ppu21I YACGTR 1 cut(s) 284
Psp1406I AACGTT 1 cut(s) 343
Psp6I CCWGG 1 cut(s) 84
PspFI CCCAGC 1 cut(s) 46
PspGI CCWGG 1 cut(s) 84
PspPI GGNCC 1 cut(s) 464
PsuI RGATCY 2 cut(s) 13, 52
RsaI GTAC 1 cut(s) 282
RsaNI GTAC 1 cut(s) 281
SapI GCTCTTC 1 cut(s) 36
SaqAI TTAA 1 cut(s) 276
Sau3AI GATC 5 cut(s) 13, 52, 115, 127, 385
Sau96I GGNCC 1 cut(s) 464
ScrFI CCNGG 1 cut(s) 86
SduI GDGCHC 1 cut(s) 250
SetI ASST 7 cut(s) 48, 63, 175, 282, 286, 346, 367
SfcI CTRYAG 2 cut(s) 9, 185
SinI GGWCC 1 cut(s) 464
Sse9I AATT 2 cut(s) 320, 372
SsiI CCGC 2 cut(s) 147, 160
SspMI CTAG 4 cut(s) 122, 315, 356, 452
StyD4I CCNGG 1 cut(s) 84
StyI CCWWGG 2 cut(s) 155, 361
TaaI ACNGT 2 cut(s) 220, 439
TaiI ACGT 3 cut(s) 63, 286, 346
TaqI TCGA 3 cut(s) 29, 63, 114
TasI AATT 2 cut(s) 320, 372
TfiI GAWTC 2 cut(s) 75, 352
Tru1I TTAA 1 cut(s) 276
Tru9I TTAA 1 cut(s) 276
TscAI CASTG 2 cut(s) 223, 427
TseFI GTSAC 2 cut(s) 284, 397
Tsp45I GTSAC 2 cut(s) 284, 397
TspDTI ATGAA 4 cut(s) 35, 313, 351, 443
TspRI CASTG 2 cut(s) 223, 427
VpaK11BI GGWCC 1 cut(s) 464
XapI RAATTY 1 cut(s) 320
XspI CTAG 4 cut(s) 122, 315, 356, 452
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.