Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001317.1

Orthogroup ID

OG0020730

Physical Location & Seq

Genomic Coordinates Reverse (-)

27428 .. 28974

Gene Structure 1547 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 681 bp

atggcccttactggatttgaagctgctgctttaaaggatcctggtctctatgctaccgaagaggttcaaaagattgttaaccatcttgataagctagataatttgttaaggctagaacacgagcttggttttgcactcttgccaagtcaaattggatcaggagttcagaaactgcttctccgtggcaaatggtcgaacaccttatatgcacttttttggagctactttgcagcgatcaggggagtaaacccagtagttcagccattgatagatttgaatatgaatgttcttgtttataatggtgagatctttggggggattgagattgctagtgaggagaatgatggtgaagttctaatggggttgctgggagggtgtgaaagttgtgtgccaaatgtggtttctaggatcaaggggccttgggctatcatctattggcaggtaacttttgagtggttggtgtgcgaggacataactgggggtctagaggatattgccattccagctagcaatttggtcgatgatccgcctgttgctcctactggcaagttgatcatgttcatggagttggtgtgcgaggacataactgggggtctagaggatattgccattccagctagcaatttggtcgatgatccgcctgttgctcctacaggcaagttgatcatgttcatggagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004066 GO:0005488 GO:0005515 GO:0006082 GO:0006520 GO:0006528 GO:0006529 GO:0006807 GO:0008150 GO:0008152 GO:0008652 GO:0009058 GO:0009066 GO:0009067 GO:0009987 GO:0016053 GO:0016874 GO:0016879 GO:0016884 GO:0019752 GO:0032787 GO:0034641 GO:0042802 GO:0042803 GO:0043436 GO:0043603 GO:0043604 GO:0044237 GO:0044238 GO:0044249 GO:0044271 GO:0044281 GO:0044283 GO:0046394 GO:0046983 GO:0071704 GO:0072330 GO:1901564 GO:1901566 GO:1901576 GO:1901605 GO:1901607

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Asn_synthase GATase_7

Protein Analysis

226

Amino Acids

24.59

Weight (kDa)

4.24

Isoelectric Point (pI)

29.37

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020730)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0001317.1_g000011
rosa_rugosa	Rorug06G0179000 Rorug06G0179100
rosa_samantha	Rh5AG465600 Rh5CG417000 Rh7CG201200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	297
Acc36I	ACCTGC	1 cut(s)	430
AciI	CCGC	2 cut(s)	527, 638
AclWI	GGATC	6 cut(s)	32, 45, 163, 416, 518, 629
AgsI	TTSAA	3 cut(s)	20, 68, 277
AjnI	CCWGG	1 cut(s)	40
AjuI	GAANNNNNNNTTGG	4 cut(s)	108, 140, 385, 417
AloI	GAACNNNNNNTCC	2 cut(s)	147, 179
AluBI	AGCT	6 cut(s)	23, 94, 124, 222, 506, 617
AluI	AGCT	6 cut(s)	23, 94, 124, 222, 506, 617
Alw26I	GTCTC	1 cut(s)	50
AlwI	GGATC	6 cut(s)	32, 45, 163, 416, 518, 629
AlwNI	CAGNNNCTG	1 cut(s)	172
AoxI	GGCC	2 cut(s)	3, 416
ApeKI	GCWGC	3 cut(s)	23, 26, 230
Asp700I	GAANNNNTTC	1 cut(s)	63
AspS9I	GGNCC	2 cut(s)	4, 416
AsuHPI	GGTGA	2 cut(s)	314, 359
AsuNHI	GCTAGC	2 cut(s)	506, 617
BamHI	GGATCC	1 cut(s)	37
BauI	CACGAG	1 cut(s)	119
BbvI	GCAGC	3 cut(s)	10, 13, 242
BccI	CCATC	2 cut(s)	90, 338
BcgI	CGANNNNNNTGC	4 cut(s)	499, 533, 610, 644
BciT130I	CCWGG	1 cut(s)	42
BclI	TGATCA	2 cut(s)	552, 663
BcoDI	GTCTC	1 cut(s)	50
BfaI	CTAG	8 cut(s)	95, 113, 330, 405, 485, 507, 596, 618
BfmI	CTRYAG	1 cut(s)	651
BfuAI	ACCTGC	1 cut(s)	430
BglII	AGATCT	1 cut(s)	306
BisI	GCNGC	3 cut(s)	24, 27, 231
BlsI	GCNGC	3 cut(s)	25, 28, 232
Bme1390I	CCNGG	1 cut(s)	42
BmgT120I	GGNCC	2 cut(s)	4, 416
BmiI	GGNNCC	2 cut(s)	39, 417
BmrFI	CCNGG	1 cut(s)	42
BmrI	ACTGGG	3 cut(s)	245, 486, 597
BmtI	GCTAGC	2 cut(s)	510, 621
BmuI	ACTGGG	3 cut(s)	245, 486, 597
BsaI	GGTCTC	1 cut(s)	50
BsaJI	CCNNGG	2 cut(s)	181, 419
BsaXI	ACNNNNNCTCC	4 cut(s)	162, 192, 557, 587
Bse1I	ACTGG	5 cut(s)	16, 251, 481, 547, 592
BseBI	CCWGG	1 cut(s)	42
BseDI	CCNNGG	2 cut(s)	181, 419
BseNI	ACTGG	5 cut(s)	16, 251, 481, 547, 592
BseRI	GAGGAG	1 cut(s)	350
BseXI	GCAGC	3 cut(s)	10, 13, 242
BseYI	CCCAGC	1 cut(s)	367
BshFI	GGCC	2 cut(s)	5, 418
BsmAI	GTCTC	1 cut(s)	50
BsnI	GGCC	2 cut(s)	5, 418
Bso31I	GGTCTC	1 cut(s)	50
Bsp143I	GATC	9 cut(s)	37, 155, 234, 306, 408, 523, 552, 634, 663
BspACI	CCGC	2 cut(s)	527, 638
BspANI	GGCC	2 cut(s)	5, 418
BspLI	GGNNCC	2 cut(s)	39, 417
BspMI	ACCTGC	1 cut(s)	430
BspOI	GCTAGC	2 cut(s)	510, 621
BspPI	GGATC	6 cut(s)	32, 45, 163, 416, 518, 629
BspTNI	GGTCTC	1 cut(s)	50
BsrI	ACTGG	5 cut(s)	16, 251, 481, 547, 592
BssECI	CCNNGG	2 cut(s)	181, 419
BssMI	GATC	9 cut(s)	37, 155, 234, 306, 408, 523, 552, 634, 663
BssSI	CACGAG	1 cut(s)	119
BssT1I	CCWWGG	1 cut(s)	419
Bst2BI	CACGAG	1 cut(s)	119
Bst2UI	CCWGG	1 cut(s)	42
Bst6I	CTCTTC	1 cut(s)	54
BstC8I	GCNNGC	2 cut(s)	508, 619
BstDSI	CCRYGG	1 cut(s)	181
BstKTI	GATC	9 cut(s)	40, 158, 237, 309, 411, 526, 555, 637, 666
BstMAI	GTCTC	1 cut(s)	50
BstMBI	GATC	9 cut(s)	37, 155, 234, 306, 408, 523, 552, 634, 663
BstMWI	GCNNNNNNNGC	2 cut(s)	503, 614
BstNI	CCWGG	1 cut(s)	42
BstSCI	CCNGG	1 cut(s)	40
BstSFI	CTRYAG	1 cut(s)	651
BstV1I	GCAGC	3 cut(s)	10, 13, 242
BstX2I	RGATCY	2 cut(s)	37, 306
BstYI	RGATCY	2 cut(s)	37, 306
BsuRI	GGCC	2 cut(s)	5, 418
BtgI	CCRYGG	1 cut(s)	181
BveI	ACCTGC	1 cut(s)	430
Cac8I	GCNNGC	2 cut(s)	508, 619
CaiI	CAGNNNCTG	1 cut(s)	172
Cfr13I	GGNCC	2 cut(s)	4, 416
CviAII	CATG	4 cut(s)	556, 562, 667, 673
DpnI	GATC	9 cut(s)	39, 157, 236, 308, 410, 525, 554, 636, 665
DpnII	GATC	9 cut(s)	37, 155, 234, 306, 408, 523, 552, 634, 663
DraI	TTTAAA	1 cut(s)	33
Eam1104I	CTCTTC	1 cut(s)	54
EarI	CTCTTC	1 cut(s)	54
EciI	GGCGGA	2 cut(s)	516, 627
Eco130I	CCWWGG	1 cut(s)	419
Eco31I	GGTCTC	1 cut(s)	50
EcoO109I	RGGNCCY	1 cut(s)	416
EcoRII	CCWGG	1 cut(s)	40
EcoT14I	CCWWGG	1 cut(s)	419
ErhI	CCWWGG	1 cut(s)	419
FaeI	CATG	4 cut(s)	559, 565, 670, 676
FatI	CATG	4 cut(s)	555, 561, 666, 672
FbaI	TGATCA	2 cut(s)	552, 663
Fnu4HI	GCNGC	3 cut(s)	24, 27, 231
Fsp4HI	GCNGC	3 cut(s)	24, 27, 231
FspBI	CTAG	8 cut(s)	95, 113, 330, 405, 485, 507, 596, 618
GluI	GCNGC	3 cut(s)	24, 27, 231
GsaI	CCCAGC	1 cut(s)	371
HaeIII	GGCC	2 cut(s)	5, 418
Hin1II	CATG	4 cut(s)	559, 565, 670, 676
HincII	GTYRAC	1 cut(s)	79
HindII	GTYRAC	1 cut(s)	79
HpaI	GTTAAC	1 cut(s)	79
HphI	GGTGA	2 cut(s)	314, 359
Hpy166II	GTNNAC	2 cut(s)	79, 247
Hpy188I	TCNGA	1 cut(s)	168
Hpy188III	TCNNGA	4 cut(s)	86, 159, 485, 596
Hpy8I	GTNNAC	2 cut(s)	79, 247
HpyCH4V	TGCA	3 cut(s)	134, 209, 230
HpyF10VI	GCNNNNNNNGC	2 cut(s)	503, 614
Hsp92II	CATG	4 cut(s)	559, 565, 670, 676
Ksp22I	TGATCA	2 cut(s)	552, 663
KspAI	GTTAAC	1 cut(s)	79
Kzo9I	GATC	9 cut(s)	37, 155, 234, 306, 408, 523, 552, 634, 663
LmnI	GCTCC	3 cut(s)	219, 541, 652
Lsp1109I	GCAGC	3 cut(s)	10, 13, 242
MaeI	CTAG	8 cut(s)	95, 113, 330, 405, 485, 507, 596, 618
MaeIII	GTNAC	1 cut(s)	442
MalI	GATC	9 cut(s)	39, 157, 236, 308, 410, 525, 554, 636, 665
MboI	GATC	9 cut(s)	37, 155, 234, 306, 408, 523, 552, 634, 663
MboII	GAAGA	1 cut(s)	71
MflI	RGATCY	2 cut(s)	37, 306
MluCI	AATT	4 cut(s)	100, 150, 511, 622
MnlI	CCTC	7 cut(s)	55, 328, 365, 460, 481, 571, 592
MroXI	GAANNNNTTC	1 cut(s)	63
MseI	TTAA	3 cut(s)	32, 78, 107
MslI	CAYNNNNRTG	2 cut(s)	560, 671
MspR9I	CCNGG	1 cut(s)	42
MvaI	CCWGG	1 cut(s)	42
MwoI	GCNNNNNNNGC	2 cut(s)	503, 614
NdeII	GATC	9 cut(s)	37, 155, 234, 306, 408, 523, 552, 634, 663
NheI	GCTAGC	2 cut(s)	506, 617
NlaIII	CATG	4 cut(s)	559, 565, 670, 676
NlaIV	GGNNCC	2 cut(s)	39, 417
PdmI	GAANNNNTTC	1 cut(s)	63
PkrI	GCNGC	3 cut(s)	25, 28, 232
PsiI	TTATAA	1 cut(s)	297
Psp6I	CCWGG	1 cut(s)	40
PspFI	CCCAGC	1 cut(s)	367
PspGI	CCWGG	1 cut(s)	40
PspN4I	GGNNCC	2 cut(s)	39, 417
PspPI	GGNCC	2 cut(s)	4, 416
PstNI	CAGNNNCTG	1 cut(s)	172
PsuI	RGATCY	2 cut(s)	37, 306
RseI	CAYNNNNRTG	2 cut(s)	560, 671
SaqAI	TTAA	3 cut(s)	32, 78, 107
SatI	GCNGC	3 cut(s)	24, 27, 231
Sau3AI	GATC	9 cut(s)	37, 155, 234, 306, 408, 523, 552, 634, 663
Sau96I	GGNCC	2 cut(s)	4, 416
ScrFI	CCNGG	1 cut(s)	42
SetI	ASST	9 cut(s)	25, 66, 96, 126, 203, 224, 444, 508, 619
SfcI	CTRYAG	1 cut(s)	651
SmiMI	CAYNNNNRTG	2 cut(s)	560, 671
Sse9I	AATT	4 cut(s)	100, 150, 511, 622
SsiI	CCGC	2 cut(s)	527, 638
SspMI	CTAG	8 cut(s)	95, 113, 330, 405, 485, 507, 596, 618
StyD4I	CCNGG	1 cut(s)	40
StyI	CCWWGG	1 cut(s)	419
TaqI	TCGA	3 cut(s)	194, 519, 630
TasI	AATT	4 cut(s)	100, 150, 511, 622
Tru1I	TTAA	3 cut(s)	32, 78, 107
Tru9I	TTAA	3 cut(s)	32, 78, 107
TseI	GCWGC	3 cut(s)	23, 26, 230
TspDTI	ATGAA	3 cut(s)	296, 550, 661
TspGWI	ACGGA	1 cut(s)	170
XbaI	TCTAGA	2 cut(s)	484, 595
XmnI	GAANNNNTTC	1 cut(s)	63
XspI	CTAG	8 cut(s)	95, 113, 330, 405, 485, 507, 596, 618

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.