Rmu_sc0001374.1_g000002

Phosphopantetheine attachment site

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001374.1
OG0021646
Physical Location & Seq
Reverse (-)
4970 .. 5317
348 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001374.1_g000002.1.cds

Sequence Viewer

Length: 348 bp
atgatggatatgggtgatgttgaaaaggagttgtgcagtaaagtacagaccattgactactacacaactattttgaaggttaaagggatagagcatatgcctataggtttctattactttagtgaatacataagtaatcctgcaacaattggagatccagttgcaatgcagagattctttgctgatgcagatattttcttattttggtcttacggaaattctgtcgacgttatggaaccaactgtgacagaacttgcaattgaagctgttaaacgtatagggggagaagttaaggagatggttctccagttccggtctaagtactttcctctagggctgggactttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AMP-binding Amino_oxidase Catalase Hexapep NAD_binding_8 PP-binding

Protein Analysis

115

Amino Acids

13.1

Weight (kDa)

4.64

Isoelectric Point (pI)

35.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021646)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001374.1_g000002
rosa_roxburghii Rroxscaffold_2G00107600
rosa_rugosa Rorug02G0338600
rosa_samantha Rh3BG156500 Rh5AG462200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 225
AclWI GGATC 1 cut(s) 149
AcsI RAATTY 1 cut(s) 217
AfaI GTAC 2 cut(s) 45, 323
AgsI TTSAA 3 cut(s) 23, 76, 263
AluBI AGCT 1 cut(s) 266
AluI AGCT 1 cut(s) 266
AlwI GGATC 1 cut(s) 149
ApoI RAATTY 1 cut(s) 217
AsuHPI GGTGA 1 cut(s) 26
BccI CCATC 1 cut(s) 292
BfaI CTAG 1 cut(s) 332
BfmI CTRYAG 1 cut(s) 102
BmcAI AGTACT 1 cut(s) 323
BmiI GGNNCC 1 cut(s) 237
BmsI GCATC 1 cut(s) 175
BpmI CTGGAG 1 cut(s) 290
BsaWI WCCGGW 1 cut(s) 312
BsaXI ACNNNNNCTCC 2 cut(s) 144, 174
Bse1I ACTGG 2 cut(s) 158, 307
Bse3DI GCAATG 1 cut(s) 171
BseMI GCAATG 1 cut(s) 171
BseNI ACTGG 2 cut(s) 158, 307
BseYI CCCAGC 1 cut(s) 337
BsgI GTGCAG 1 cut(s) 55
BsiSI CCGG 1 cut(s) 313
Bsp143I GATC 1 cut(s) 154
BspLI GGNNCC 1 cut(s) 237
BspPI GGATC 1 cut(s) 149
BsrDI GCAATG 1 cut(s) 171
BsrI ACTGG 2 cut(s) 158, 307
BssMI GATC 1 cut(s) 154
Bst4CI ACNGT 1 cut(s) 244
BstDEI CTNAG 1 cut(s) 318
BstKTI GATC 1 cut(s) 157
BstMBI GATC 1 cut(s) 154
BstMWI GCNNNNNNNGC 1 cut(s) 263
BstSFI CTRYAG 1 cut(s) 102
BstX2I RGATCY 1 cut(s) 154
BstYI RGATCY 1 cut(s) 154
Csp6I GTAC 2 cut(s) 44, 322
CviJI RGCY 2 cut(s) 266, 337
CviKI_1 RGCY 2 cut(s) 266, 337
CviQI GTAC 2 cut(s) 44, 322
DdeI CTNAG 1 cut(s) 318
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
FaiI YATR 7 cut(s) 11, 96, 98, 104, 131, 233, 278
FauNDI CATATG 1 cut(s) 96
FblI GTMKAC 1 cut(s) 225
FspBI CTAG 1 cut(s) 332
GsaI CCCAGC 1 cut(s) 341
GsuI CTGGAG 1 cut(s) 290
HapII CCGG 1 cut(s) 313
HincII GTYRAC 1 cut(s) 226
HindII GTYRAC 1 cut(s) 226
HinfI GANTC 1 cut(s) 174
HpaII CCGG 1 cut(s) 313
HphI GGTGA 1 cut(s) 26
Hpy166II GTNNAC 1 cut(s) 226
Hpy8I GTNNAC 1 cut(s) 226
Hpy99I CGWCG 1 cut(s) 230
HpyAV CCTTC 1 cut(s) 70
HpyCH4III ACNGT 1 cut(s) 244
HpyCH4IV ACGT 2 cut(s) 228, 274
HpyCH4V TGCA 6 cut(s) 36, 143, 164, 169, 188, 257
HpyF10VI GCNNNNNNNGC 1 cut(s) 263
HpyF3I CTNAG 1 cut(s) 318
HpySE526I ACGT 2 cut(s) 228, 274
Kzo9I GATC 1 cut(s) 154
LpnPI CCDG 5 cut(s) 153, 171, 320, 323, 326
LweI GCATC 1 cut(s) 175
MaeI CTAG 1 cut(s) 332
MaeII ACGT 2 cut(s) 228, 274
MaeIII GTNAC 1 cut(s) 244
MalI GATC 1 cut(s) 156
MboI GATC 1 cut(s) 154
MfeI CAATTG 2 cut(s) 147, 258
MflI RGATCY 1 cut(s) 154
MluCI AATT 3 cut(s) 147, 217, 258
MnlI CCTC 1 cut(s) 339
MseI TTAA 3 cut(s) 81, 270, 291
MspI CCGG 1 cut(s) 313
MunI CAATTG 2 cut(s) 147, 258
MwoI GCNNNNNNNGC 1 cut(s) 263
NdeI CATATG 1 cut(s) 96
NdeII GATC 1 cut(s) 154
NlaIV GGNNCC 1 cut(s) 237
NmuCI GTSAC 1 cut(s) 244
PfeI GAWTC 1 cut(s) 174
PspFI CCCAGC 1 cut(s) 337
PspN4I GGNNCC 1 cut(s) 237
PsuI RGATCY 1 cut(s) 154
RsaI GTAC 2 cut(s) 45, 323
RsaNI GTAC 2 cut(s) 44, 322
SalI GTCGAC 1 cut(s) 224
SaqAI TTAA 3 cut(s) 81, 270, 291
Sau3AI GATC 1 cut(s) 154
ScaI AGTACT 1 cut(s) 323
SetI ASST 5 cut(s) 81, 109, 231, 268, 277
SfaNI GCATC 1 cut(s) 175
SfcI CTRYAG 1 cut(s) 102
SgeI CNNG 6 cut(s) 152, 170, 266, 319, 325, 344
Sse9I AATT 3 cut(s) 147, 217, 258
SspMI CTAG 1 cut(s) 332
TaaI ACNGT 1 cut(s) 244
TaiI ACGT 2 cut(s) 231, 277
TaqI TCGA 1 cut(s) 225
TasI AATT 3 cut(s) 147, 217, 258
TatI WGTACW 2 cut(s) 43, 321
TfiI GAWTC 1 cut(s) 174
Tru1I TTAA 3 cut(s) 81, 270, 291
Tru9I TTAA 3 cut(s) 81, 270, 291
TseFI GTSAC 1 cut(s) 244
Tsp45I GTSAC 1 cut(s) 244
TspGWI ACGGA 1 cut(s) 228
XapI RAATTY 1 cut(s) 217
XmiI GTMKAC 1 cut(s) 225
XspI CTAG 1 cut(s) 332
ZrmI AGTACT 1 cut(s) 323
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.