Rorug02G0338600

Phosphopantetheine attachment site

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0021646
Physical Location & Seq
Reverse (-)
42049325 .. 42049735
411 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0338600.1

Sequence Viewer

Length: 411 bp
ATGGACATTCTACTTAGTCCAAAGAAGCTCATCAAACTGACCAGGAACTTCCAGAAGCTACCAGTTATTGGGAGAAGGAAAACTTCATACCAAAGAGCAGCTGTCGACGGTAACAGGATGAATACTAGTACTGCAGATAAAGGCACGTTCGTTATCTACACCCTTGACAAGAGGCGCTTTGTGCTTCCCTTGTCCTATCTTTCTAACTACATTTTCCAAGAGCTATTCAAGATGTCTGAAGAAGAATTTGGAATATCGAGTAGTGATCCAATTGTTATCCCATGCGATTCACGCCTCATGGACTACATAGTCTCACTAGTGAAGCTTGGAATGAGTGTAGAGTTGGAGAAAGCTTTACTCAACTCTATCTTTAGAAGTAGTTTGAAAATACCAGATAGAACAATATGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AMP-binding Amino_oxidase Catalase Hexapep NAD_binding_8 PP-binding

Protein Analysis

136

Amino Acids

15.59

Weight (kDa)

9.58

Isoelectric Point (pI)

42.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 8 - 106 1.2e-25 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021646)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001374.1_g000002
rosa_roxburghii Rroxscaffold_2G00107600
rosa_rugosa Rorug02G0338600
rosa_samantha Rh3BG156500 Rh5AG462200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 308
AccB7I CCANNNNNTGG 1 cut(s) 68
AccI GTMKAC 1 cut(s) 105
AclWI GGATC 1 cut(s) 260
AcsI RAATTY 1 cut(s) 245
AcuI CTGAAG 1 cut(s) 258
AfaI GTAC 1 cut(s) 130
AfiI CCNNNNNNNGG 1 cut(s) 68
AgsI TTSAA 2 cut(s) 229, 385
AhlI ACTAGT 2 cut(s) 125, 316
AjnI CCWGG 1 cut(s) 41
AjuI GAANNNNNNNTTGG 2 cut(s) 231, 263
AluBI AGCT 6 cut(s) 28, 58, 101, 223, 325, 353
AluI AGCT 6 cut(s) 28, 58, 101, 223, 325, 353
Alw26I GTCTC 1 cut(s) 316
AlwI GGATC 1 cut(s) 260
ApeKI GCWGC 1 cut(s) 98
ApoI RAATTY 1 cut(s) 245
AspLEI GCGC 1 cut(s) 177
BbvI GCAGC 1 cut(s) 110
BciT130I CCWGG 1 cut(s) 43
BcoDI GTCTC 1 cut(s) 316
BcuI ACTAGT 2 cut(s) 125, 316
BfaI CTAG 2 cut(s) 126, 317
BfmI CTRYAG 1 cut(s) 132
BfoI RGCGCY 1 cut(s) 178
BisI GCNGC 1 cut(s) 99
BlsI GCNGC 1 cut(s) 100
BmcAI AGTACT 1 cut(s) 130
Bme1390I CCNGG 1 cut(s) 43
BmrFI CCNGG 1 cut(s) 43
Bsc4I CCNNNNNNNGG 1 cut(s) 68
Bse1I ACTGG 1 cut(s) 62
BseBI CCWGG 1 cut(s) 43
BseGI GGATG 1 cut(s) 123
BseLI CCNNNNNNNGG 1 cut(s) 68
BseNI ACTGG 1 cut(s) 62
BseXI GCAGC 1 cut(s) 110
BslI CCNNNNNNNGG 1 cut(s) 68
BsmAI GTCTC 1 cut(s) 316
Bsp143I GATC 1 cut(s) 265
BspMAI CTGCAG 1 cut(s) 136
BspPI GGATC 1 cut(s) 260
BsrI ACTGG 1 cut(s) 62
BssMI GATC 1 cut(s) 265
Bst2UI CCWGG 1 cut(s) 43
Bst4CI ACNGT 1 cut(s) 110
BstDEI CTNAG 1 cut(s) 14
BstF5I GGATG 1 cut(s) 123
BstH2I RGCGCY 1 cut(s) 178
BstHHI GCGC 1 cut(s) 177
BstKTI GATC 1 cut(s) 268
BstMAI GTCTC 1 cut(s) 316
BstMBI GATC 1 cut(s) 265
BstMWI GCNNNNNNNGC 2 cut(s) 181, 291
BstNI CCWGG 1 cut(s) 43
BstSCI CCNGG 1 cut(s) 41
BstSFI CTRYAG 1 cut(s) 132
BstV1I GCAGC 1 cut(s) 110
BtsCI GGATG 1 cut(s) 123
CfoI GCGC 1 cut(s) 177
Csp6I GTAC 1 cut(s) 129
CviAII CATG 2 cut(s) 282, 298
CviJI RGCY 6 cut(s) 28, 58, 101, 223, 325, 353
CviKI_1 RGCY 6 cut(s) 28, 58, 101, 223, 325, 353
CviQI GTAC 1 cut(s) 129
DdeI CTNAG 1 cut(s) 14
DpnI GATC 1 cut(s) 267
DpnII GATC 1 cut(s) 265
DrdI GACNNNNNNGTC 1 cut(s) 308
DseDI GACNNNNNNGTC 1 cut(s) 308
Eco57I CTGAAG 1 cut(s) 258
EcoRII CCWGG 1 cut(s) 41
FaeI CATG 2 cut(s) 285, 301
FaiI YATR 5 cut(s) 88, 283, 299, 308, 406
FalI AAGNNNNNCTT 4 cut(s) 67, 99, 161, 193
FatI CATG 2 cut(s) 281, 297
FblI GTMKAC 1 cut(s) 105
Fnu4HI GCNGC 1 cut(s) 99
FokI GGATG 1 cut(s) 130
Fsp4HI GCNGC 1 cut(s) 99
FspBI CTAG 2 cut(s) 126, 317
GlaI GCGC 1 cut(s) 176
GluI GCNGC 1 cut(s) 99
HaeII RGCGCY 1 cut(s) 178
HhaI GCGC 1 cut(s) 177
Hin1II CATG 2 cut(s) 285, 301
Hin6I GCGC 1 cut(s) 175
HinP1I GCGC 1 cut(s) 175
HincII GTYRAC 1 cut(s) 106
HindII GTYRAC 1 cut(s) 106
HindIII AAGCTT 2 cut(s) 323, 351
HinfI GANTC 1 cut(s) 287
Hpy166II GTNNAC 1 cut(s) 106
Hpy188I TCNGA 1 cut(s) 238
Hpy188III TCNNGA 2 cut(s) 52, 229
Hpy8I GTNNAC 1 cut(s) 106
Hpy99I CGWCG 1 cut(s) 110
HpyAV CCTTC 1 cut(s) 69
HpyCH4III ACNGT 1 cut(s) 110
HpyCH4IV ACGT 1 cut(s) 146
HpyCH4V TGCA 1 cut(s) 134
HpyF10VI GCNNNNNNNGC 2 cut(s) 181, 291
HpyF3I CTNAG 1 cut(s) 14
HpySE526I ACGT 1 cut(s) 146
Hsp92II CATG 2 cut(s) 285, 301
HspAI GCGC 1 cut(s) 175
Kzo9I GATC 1 cut(s) 265
LpnPI CCDG 6 cut(s) 28, 55, 65, 75, 100, 405
Lsp1109I GCAGC 1 cut(s) 110
MaeI CTAG 2 cut(s) 126, 317
MaeII ACGT 1 cut(s) 146
MaeIII GTNAC 1 cut(s) 110
MalI GATC 1 cut(s) 267
MboI GATC 1 cut(s) 265
MboII GAAGA 2 cut(s) 251, 254
MfeI CAATTG 1 cut(s) 270
MluCI AATT 2 cut(s) 245, 270
MmeI TCCRAC 1 cut(s) 324
MnlI CCTC 2 cut(s) 165, 305
MspA1I CMGCKG 1 cut(s) 101
MspR9I CCNGG 1 cut(s) 43
MunI CAATTG 1 cut(s) 270
MvaI CCWGG 1 cut(s) 43
MwoI GCNNNNNNNGC 2 cut(s) 181, 291
NdeII GATC 1 cut(s) 265
NlaIII CATG 2 cut(s) 285, 301
PfeI GAWTC 1 cut(s) 287
PflMI CCANNNNNTGG 1 cut(s) 68
PkrI GCNGC 1 cut(s) 100
Psp6I CCWGG 1 cut(s) 41
PspGI CCWGG 1 cut(s) 41
PstI CTGCAG 1 cut(s) 136
PvuII CAGCTG 1 cut(s) 101
RsaI GTAC 1 cut(s) 130
RsaNI GTAC 1 cut(s) 129
SalI GTCGAC 1 cut(s) 104
SatI GCNGC 1 cut(s) 99
Sau3AI GATC 1 cut(s) 265
ScaI AGTACT 1 cut(s) 130
ScrFI CCNGG 1 cut(s) 43
SetI ASST 7 cut(s) 30, 60, 103, 149, 225, 327, 355
SfcI CTRYAG 1 cut(s) 132
SpeI ACTAGT 2 cut(s) 125, 316
Sse9I AATT 2 cut(s) 245, 270
SspMI CTAG 2 cut(s) 126, 317
StyD4I CCNGG 1 cut(s) 41
TaaI ACNGT 1 cut(s) 110
TaiI ACGT 1 cut(s) 149
TaqI TCGA 2 cut(s) 105, 257
TasI AATT 2 cut(s) 245, 270
TatI WGTACW 1 cut(s) 128
TfiI GAWTC 1 cut(s) 287
TseI GCWGC 1 cut(s) 98
TspDTI ATGAA 2 cut(s) 75, 134
Van91I CCANNNNNTGG 1 cut(s) 68
XapI RAATTY 1 cut(s) 245
XmiI GTMKAC 1 cut(s) 105
XspI CTAG 2 cut(s) 126, 317
ZrmI AGTACT 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.