Rmu_sc0001556.1_g000011

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001556.1
OG0023072
Physical Location & Seq
Forward (+)
42730 .. 43068
339 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 339 bp
atgcaagtggaactattagaaattagagaaggcctagacttcctcaagcagagaggccttcgtgatgtatgccttgaaagtgactgtcaaggagcgatccaagacattgatactggggactgtgacttaaatgaaaacgcaaacctgttgctcgacatccaacagtgtagtaagtttgtgtataatttgaaattctcctttgctcctagaactgctaattttgtggtgcatacgttggcagcttttgcttatgaatccaatactcctaatatatggatagaccaagctccaataaatattctggatgctatagcttctggttgtattcgattgaattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

112

Amino Acids

12.55

Weight (kDa)

4.33

Isoelectric Point (pI)

25.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 2 - 83 1.9e-10 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023072)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001556.1_g000011 Rmu_sc0004591.1_g000007 Rmu_sc0010224.1_g000004
rosa_roxburghii Rroxscaffold_2G00087670

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 91
AcsI RAATTY 1 cut(s) 191
AgsI TTSAA 3 cut(s) 77, 190, 334
AluBI AGCT 3 cut(s) 242, 287, 314
AluI AGCT 3 cut(s) 242, 287, 314
AlwI GGATC 1 cut(s) 91
AoxI GGCC 2 cut(s) 31, 55
ApeKI GCWGC 1 cut(s) 239
ApoI RAATTY 1 cut(s) 191
BbvI GCAGC 1 cut(s) 251
BfaI CTAG 2 cut(s) 35, 207
BfmI CTRYAG 1 cut(s) 309
BisI GCNGC 1 cut(s) 240
BlsI GCNGC 1 cut(s) 241
BmrI ACTGGG 1 cut(s) 123
BmsI GCATC 1 cut(s) 295
BmuI ACTGGG 1 cut(s) 123
BpuEI CTTGAG 1 cut(s) 29
Bse1I ACTGG 1 cut(s) 118
BseGI GGATG 2 cut(s) 156, 310
BseNI ACTGG 1 cut(s) 118
BseXI GCAGC 1 cut(s) 251
BshFI GGCC 2 cut(s) 33, 57
BslFI GGGAC 1 cut(s) 131
BsmFI GGGAC 1 cut(s) 131
BsnI GGCC 2 cut(s) 33, 57
Bsp143I GATC 1 cut(s) 96
BspANI GGCC 2 cut(s) 33, 57
BspPI GGATC 1 cut(s) 91
BsrI ACTGG 1 cut(s) 118
BssMI GATC 1 cut(s) 96
Bst4CI ACNGT 3 cut(s) 86, 122, 165
BstAPI GCANNNNNTGC 1 cut(s) 245
BstF5I GGATG 2 cut(s) 156, 310
BstKTI GATC 1 cut(s) 99
BstMBI GATC 1 cut(s) 96
BstMWI GCNNNNNNNGC 1 cut(s) 245
BstSFI CTRYAG 1 cut(s) 309
BstV1I GCAGC 1 cut(s) 251
BsuRI GGCC 2 cut(s) 33, 57
BtsCI GGATG 2 cut(s) 156, 310
BtsIMutI CAGTG 1 cut(s) 170
CviJI RGCY 5 cut(s) 33, 57, 242, 287, 314
CviKI_1 RGCY 5 cut(s) 33, 57, 242, 287, 314
DpnI GATC 1 cut(s) 98
DpnII GATC 1 cut(s) 96
Eco147I AGGCCT 2 cut(s) 33, 57
FaiI YATR 7 cut(s) 70, 183, 231, 252, 272, 274, 311
FaqI GGGAC 1 cut(s) 131
Fnu4HI GCNGC 1 cut(s) 240
FokI GGATG 2 cut(s) 143, 317
Fsp4HI GCNGC 1 cut(s) 240
FspBI CTAG 2 cut(s) 35, 207
GluI GCNGC 1 cut(s) 240
HaeIII GGCC 2 cut(s) 33, 57
HinfI GANTC 1 cut(s) 254
Hpy188III TCNNGA 2 cut(s) 62, 302
HpyAV CCTTC 2 cut(s) 23, 68
HpyCH4III ACNGT 3 cut(s) 86, 122, 165
HpyCH4IV ACGT 1 cut(s) 233
HpyCH4V TGCA 2 cut(s) 4, 229
HpyF10VI GCNNNNNNNGC 1 cut(s) 245
HpySE526I ACGT 1 cut(s) 233
Kzo9I GATC 1 cut(s) 96
LmnI GCTCC 3 cut(s) 92, 208, 292
LpnPI CCDG 4 cut(s) 99, 158, 287, 303
Lsp1109I GCAGC 1 cut(s) 251
LweI GCATC 1 cut(s) 295
MaeI CTAG 2 cut(s) 35, 207
MaeII ACGT 1 cut(s) 233
MaeIII GTNAC 2 cut(s) 80, 122
MalI GATC 1 cut(s) 98
MboI GATC 1 cut(s) 96
MluCI AATT 5 cut(s) 21, 184, 191, 217, 334
MmeI TCCRAC 1 cut(s) 184
MnlI CCTC 2 cut(s) 47, 53
MseI TTAA 1 cut(s) 128
MwoI GCNNNNNNNGC 1 cut(s) 245
NdeII GATC 1 cut(s) 96
NmuCI GTSAC 2 cut(s) 80, 122
PceI AGGCCT 2 cut(s) 33, 57
PfeI GAWTC 1 cut(s) 254
PkrI GCNGC 1 cut(s) 241
SaqAI TTAA 1 cut(s) 128
SatI GCNGC 1 cut(s) 240
Sau3AI GATC 1 cut(s) 96
SetI ASST 5 cut(s) 147, 236, 244, 289, 316
SfaNI GCATC 1 cut(s) 295
SfcI CTRYAG 1 cut(s) 309
SmlI CTYRAG 1 cut(s) 44
SmoI CTYRAG 1 cut(s) 44
Sse9I AATT 5 cut(s) 21, 184, 191, 217, 334
SseBI AGGCCT 2 cut(s) 33, 57
SspI AATATT 1 cut(s) 298
SspMI CTAG 2 cut(s) 35, 207
StuI AGGCCT 2 cut(s) 33, 57
TaaI ACNGT 3 cut(s) 86, 122, 165
TaiI ACGT 1 cut(s) 236
TaqI TCGA 2 cut(s) 153, 328
TasI AATT 5 cut(s) 21, 184, 191, 217, 334
TfiI GAWTC 1 cut(s) 254
Tru1I TTAA 1 cut(s) 128
Tru9I TTAA 1 cut(s) 128
TscAI CASTG 1 cut(s) 170
TseFI GTSAC 2 cut(s) 80, 122
TseI GCWGC 1 cut(s) 239
Tsp45I GTSAC 2 cut(s) 80, 122
TspDTI ATGAA 2 cut(s) 147, 267
TspRI CASTG 1 cut(s) 170
XapI RAATTY 1 cut(s) 191
XspI CTAG 2 cut(s) 35, 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.