Rmu_sc0001575.1_g000014

Enhancer of polycomb-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001575.1
OG0020461
Physical Location & Seq
Forward (+)
78634 .. 82769
4136 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1320 bp
atgtcttgtcttagaacagatatgagggtcatcgtcgatcaacctcgcaatctcaccgagcaagaaaaaaagggcataaggattaaagttccggaagacttaaaacttgtagggttcccagcagaggttcaacggagtccaccggagtctgttcccaagtgtttgttgtcatctctcaagactatctgcataatggggttcaagggaatgggaatatatagacatctagatgagatggaagtgatcaagtatttgttaacaaatggtcgagttttggagaagatgactatttatactcctggtcttttcatgtgcacaacagaagacttctacaaggaattttcattgttcgggtggggatcgaagacttgtgaagttgagattgttaagaagatatattttattatgcatcagcgtgggcctttggctcctccagtgtgtggggatttctgccagacgggtcttgggaggctctatggtggtcgaagcggtgcgtttgtcagagaagggattgattcctcagagatggagtctcgcatcatacctgggattggattgtcccatcggtggtctagatcttttggaagggacgacggtgctgttttctggtcggtgatgatggttagcgattatcccgtggtagctgtttgggacaaggatgcagaattaggagatcaggatggtttccatcctattggaaggagatcaaatgggtttgcctatggtgatgaaaaaattgcatattcaggccataactatgaatctttagatgactctccattgtctcagacatcgcccagggttttttcaccaagggatgcagcaaacatctttatgagcaatgatggttttgagaggaatcatcttcacagaattgacagaagcaagtcaaagaaatatcggacaatagcatcctctgttgacccccagatggtgtctccatataatcatagagtggtacgaaacagaaatggagttcatagagggaatattggtttcccggagtggtcaagccagtcatattatcaaccagatgttgctcagaggcttgtaaatgcgcatggctttgatcatgatgagtttaggcttcgtgaggcatctggtgccgctcagcatgcacataacttagccaagcgtaagagagaaaatgctcgcagattgttttacagagcagatctagcaatgcacaaggctgtggttgctctcatgactgcggaagcaatcaaagcttcttcagaggactacgactatgactacgactctgagtccgattccttctccatctccgactctgacaccgattcagacagtgaagagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EPL1

Protein Analysis

439

Amino Acids

49.8

Weight (kDa)

6.29

Isoelectric Point (pI)

53.78

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FBD PF08387 48 - 97 5.8e-14 FBD
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020461)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0324891
rosa_multiflora Rmu_sc0001575.1_g000014
rosa_samantha Rh2AG433500 Rh5AG201700 Rh5BG199900 Rh5CG220200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 1059
AccB1I GGYRCC 1 cut(s) 1103
AccB7I CCANNNNNTGG 1 cut(s) 440
AccBSI CCGCTC 1 cut(s) 1109
AccIII TCCGGA 1 cut(s) 91
AciI CCGC 3 cut(s) 489, 1107, 1214
AclWI GGATC 1 cut(s) 367
AcsI RAATTY 1 cut(s) 338
AcuI CTGAAG 1 cut(s) 1218
AfaI GTAC 1 cut(s) 960
AfiI CCNNNNNNNGG 5 cut(s) 124, 440, 551, 567, 931
AgsI TTSAA 2 cut(s) 131, 202
AhdI GACNNNNNGTC 1 cut(s) 1264
AjnI CCWGG 3 cut(s) 298, 544, 797
AluBI AGCT 2 cut(s) 644, 1229
AluI AGCT 2 cut(s) 644, 1229
Alw21I GWGCWC 1 cut(s) 317
Alw26I GTCTC 3 cut(s) 537, 789, 942
Alw44I GTGCAC 1 cut(s) 313
AlwI GGATC 1 cut(s) 367
Aor13HI TCCGGA 1 cut(s) 91
AoxI GGCC 2 cut(s) 419, 748
ApaLI GTGCAC 1 cut(s) 313
ApeKI GCWGC 1 cut(s) 821
ApoI RAATTY 1 cut(s) 338
AspLEI GCGC 1 cut(s) 1060
AspS9I GGNCC 1 cut(s) 419
AsuC2I CCSGG 1 cut(s) 1001
AsuHPI GGTGA 4 cut(s) 46, 625, 737, 801
BaeGI GKGCMC 1 cut(s) 317
BanI GGYRCC 1 cut(s) 1103
BbsI GAAGAC 3 cut(s) 102, 330, 371
Bbv12I GWGCWC 1 cut(s) 317
BbvI GCAGC 1 cut(s) 833
BccI CCATC 9 cut(s) 229, 520, 570, 613, 674, 696, 839, 925, 1289
BciT130I CCWGG 3 cut(s) 300, 546, 799
BclI TGATCA 2 cut(s) 243, 1069
BcnI CCSGG 1 cut(s) 1001
BcoDI GTCTC 3 cut(s) 537, 789, 942
BfaI CTAG 3 cut(s) 227, 573, 1178
BglII AGATCT 2 cut(s) 575, 1174
BisI GCNGC 2 cut(s) 822, 1107
BlpI GCTNAGC 1 cut(s) 1110
BlsI GCNGC 2 cut(s) 823, 1108
Bme1390I CCNGG 4 cut(s) 300, 546, 799, 1001
BmeRI GACNNNNNGTC 1 cut(s) 1264
BmgT120I GGNCC 1 cut(s) 419
BmiI GGNNCC 3 cut(s) 116, 429, 1105
BmrFI CCNGG 4 cut(s) 300, 546, 799, 1001
BmsI GCATC 6 cut(s) 418, 546, 649, 808, 920, 1106
BpiI GAAGAC 3 cut(s) 102, 330, 371
BpmI CTGGAG 1 cut(s) 417
Bpu1102I GCTNAGC 1 cut(s) 1110
BpuEI CTTGAG 1 cut(s) 161
BpuMI CCSGG 1 cut(s) 1001
BsaJI CCNNGG 5 cut(s) 545, 636, 797, 798, 812
BsaWI WCCGGW 2 cut(s) 91, 142
Bsc4I CCNNNNNNNGG 5 cut(s) 124, 440, 551, 567, 931
Bse1I ACTGG 2 cut(s) 434, 1015
Bse3DI GCAATG 2 cut(s) 847, 1188
BseAI TCCGGA 1 cut(s) 91
BseBI CCWGG 3 cut(s) 300, 546, 799
BseDI CCNNGG 5 cut(s) 545, 636, 797, 798, 812
BseGI GGATG 5 cut(s) 664, 685, 688, 823, 911
BseLI CCNNNNNNNGG 5 cut(s) 124, 440, 551, 567, 931
BseMI GCAATG 2 cut(s) 847, 1188
BseMII CTCAG 5 cut(s) 534, 800, 1055, 1124, 1254
BseNI ACTGG 2 cut(s) 434, 1015
BseRI GAGGAG 1 cut(s) 420
BseSI GKGCMC 1 cut(s) 317
BseXI GCAGC 1 cut(s) 833
BseYI CCCAGC 1 cut(s) 118
BshFI GGCC 2 cut(s) 421, 750
BshNI GGYRCC 1 cut(s) 1103
BsiHKAI GWGCWC 1 cut(s) 317
BsiSI CCGG 3 cut(s) 92, 143, 1001
BslFI GGGAC 3 cut(s) 544, 602, 665
BslI CCNNNNNNNGG 5 cut(s) 124, 440, 551, 567, 931
BsmAI GTCTC 3 cut(s) 537, 789, 942
BsmFI GGGAC 3 cut(s) 544, 602, 665
BsnI GGCC 2 cut(s) 421, 750
Bsp1286I GDGCHC 1 cut(s) 317
Bsp13I TCCGGA 1 cut(s) 91
Bsp143I GATC 8 cut(s) 37, 243, 359, 575, 673, 704, 1069, 1174
Bsp1720I GCTNAGC 1 cut(s) 1110
BspACI CCGC 3 cut(s) 489, 1107, 1214
BspANI GGCC 2 cut(s) 421, 750
BspCNI CTCAG 5 cut(s) 533, 799, 1054, 1123, 1255
BspEI TCCGGA 1 cut(s) 91
BspHI TCATGA 2 cut(s) 1072, 1206
BspLI GGNNCC 3 cut(s) 116, 429, 1105
BspPI GGATC 1 cut(s) 367
BspT107I GGYRCC 1 cut(s) 1103
BsrBI CCGCTC 1 cut(s) 1109
BsrDI GCAATG 2 cut(s) 847, 1188
BsrI ACTGG 2 cut(s) 434, 1015
BssECI CCNNGG 5 cut(s) 545, 636, 797, 798, 812
BssMI GATC 8 cut(s) 37, 243, 359, 575, 673, 704, 1069, 1174
BssT1I CCWWGG 1 cut(s) 812
Bst2UI CCWGG 3 cut(s) 300, 546, 799
Bst4CI ACNGT 2 cut(s) 596, 1310
Bst6I CTCTTC 1 cut(s) 1308
BstAPI GCANNNNNTGC 1 cut(s) 1103
BstC8I GCNNGC 2 cut(s) 1116, 1153
BstDEI CTNAG 7 cut(s) 11, 520, 786, 1041, 1110, 1126, 1263
BstDSI CCRYGG 1 cut(s) 636
BstF5I GGATG 5 cut(s) 664, 685, 688, 823, 911
BstHHI GCGC 1 cut(s) 1060
BstKTI GATC 8 cut(s) 40, 246, 362, 578, 676, 707, 1072, 1177
BstMAI GTCTC 3 cut(s) 537, 789, 942
BstMBI GATC 8 cut(s) 37, 243, 359, 575, 673, 704, 1069, 1174
BstMWI GCNNNNNNNGC 5 cut(s) 1103, 1115, 1178, 1199, 1226
BstNI CCWGG 3 cut(s) 300, 546, 799
BstNSI RCATGY 1 cut(s) 1118
BstSCI CCNGG 4 cut(s) 298, 544, 797, 999
BstSLI GKGCMC 1 cut(s) 317
BstV1I GCAGC 1 cut(s) 833
BstV2I GAAGAC 3 cut(s) 102, 330, 371
BstX2I RGATCY 2 cut(s) 575, 1174
BstXI CCANNNNNNTGG 1 cut(s) 695
BstYI RGATCY 2 cut(s) 575, 1174
BsuRI GGCC 2 cut(s) 421, 750
BtgI CCRYGG 1 cut(s) 636
BtgZI GCGATG 1 cut(s) 777
BtsCI GGATG 5 cut(s) 664, 685, 688, 823, 911
BtsIMutI CAGTG 2 cut(s) 441, 1315
Cac8I GCNNGC 2 cut(s) 1116, 1153
CciI TCATGA 2 cut(s) 1072, 1206
CfoI GCGC 1 cut(s) 1060
Cfr13I GGNCC 1 cut(s) 419
Csp6I GTAC 1 cut(s) 959
CviAII CATG 5 cut(s) 310, 1061, 1073, 1115, 1207
CviQI GTAC 1 cut(s) 959
DdeI CTNAG 7 cut(s) 11, 520, 786, 1041, 1110, 1126, 1263
DpnI GATC 8 cut(s) 39, 245, 361, 577, 675, 706, 1071, 1176
DpnII GATC 8 cut(s) 37, 243, 359, 575, 673, 704, 1069, 1174
DriI GACNNNNNGTC 1 cut(s) 1264
Eam1104I CTCTTC 1 cut(s) 1308
Eam1105I GACNNNNNGTC 1 cut(s) 1264
EarI CTCTTC 1 cut(s) 1308
Eco130I CCWWGG 1 cut(s) 812
Eco57I CTGAAG 1 cut(s) 1218
EcoRII CCWGG 3 cut(s) 298, 544, 797
EcoT14I CCWWGG 1 cut(s) 812
EcoT22I ATGCAT 1 cut(s) 411
ErhI CCWWGG 1 cut(s) 812
FaeI CATG 5 cut(s) 313, 1064, 1076, 1118, 1210
FaqI GGGAC 3 cut(s) 544, 602, 665
FatI CATG 5 cut(s) 309, 1060, 1072, 1114, 1206
FbaI TGATCA 2 cut(s) 243, 1069
Fnu4HI GCNGC 2 cut(s) 822, 1107
FokI GGATG 5 cut(s) 671, 675, 692, 830, 898
Fsp4HI GCNGC 2 cut(s) 822, 1107
FspAI RTGCGCAY 1 cut(s) 1059
FspBI CTAG 3 cut(s) 227, 573, 1178
FspI TGCGCA 1 cut(s) 1059
GlaI GCGC 1 cut(s) 1059
GluI GCNGC 2 cut(s) 822, 1107
GsaI CCCAGC 1 cut(s) 122
GsuI CTGGAG 1 cut(s) 417
HaeIII GGCC 2 cut(s) 421, 750
HapII CCGG 3 cut(s) 92, 143, 1001
HhaI GCGC 1 cut(s) 1060
Hin1II CATG 5 cut(s) 313, 1064, 1076, 1118, 1210
Hin6I GCGC 1 cut(s) 1058
HinP1I GCGC 1 cut(s) 1058
HincII GTYRAC 2 cut(s) 258, 922
HindII GTYRAC 2 cut(s) 258, 922
HindIII AAGCTT 1 cut(s) 1227
HpaI GTTAAC 1 cut(s) 258
HpaII CCGG 3 cut(s) 92, 143, 1001
HphI GGTGA 4 cut(s) 46, 625, 737, 801
Hpy166II GTNNAC 4 cut(s) 140, 258, 315, 922
Hpy188III TCNNGA 8 cut(s) 92, 178, 227, 573, 677, 1073, 1091, 1207
Hpy8I GTNNAC 4 cut(s) 140, 258, 315, 922
Hpy99I CGWCG 2 cut(s) 38, 596
HpyAV CCTTC 4 cut(s) 500, 579, 693, 1285
HpyCH4III ACNGT 2 cut(s) 596, 1310
HpyCH4V TGCA 8 cut(s) 189, 315, 409, 662, 740, 821, 1118, 1186
HpyF10VI GCNNNNNNNGC 5 cut(s) 1103, 1115, 1178, 1199, 1226
HpyF3I CTNAG 7 cut(s) 11, 520, 786, 1041, 1110, 1126, 1263
Hsp92II CATG 5 cut(s) 313, 1064, 1076, 1118, 1210
HspAI GCGC 1 cut(s) 1058
Kpn2I TCCGGA 1 cut(s) 91
Ksp22I TGATCA 2 cut(s) 243, 1069
KspAI GTTAAC 1 cut(s) 258
Kzo9I GATC 8 cut(s) 37, 243, 359, 575, 673, 704, 1069, 1174
LmnI GCTCC 1 cut(s) 433
Lsp1109I GCAGC 1 cut(s) 833
LweI GCATC 6 cut(s) 418, 546, 649, 808, 920, 1106
MaeI CTAG 3 cut(s) 227, 573, 1178
MalI GATC 8 cut(s) 39, 245, 361, 577, 675, 706, 1071, 1176
MbiI CCGCTC 1 cut(s) 1109
MboI GATC 8 cut(s) 37, 243, 359, 575, 673, 704, 1069, 1174
MboII GAAGA 7 cut(s) 107, 292, 335, 376, 403, 857, 1224
MflI RGATCY 2 cut(s) 575, 1174
MhlI GDGCHC 1 cut(s) 317
MluCI AATT 4 cut(s) 338, 665, 735, 873
MlyI GAGTC 7 cut(s) 145, 155, 539, 767, 1253, 1274, 1283
MmeI TCCRAC 1 cut(s) 1311
Mph1103I ATGCAT 1 cut(s) 411
MroI TCCGGA 1 cut(s) 91
MseI TTAA 4 cut(s) 84, 101, 257, 387
MslI CAYNNNNRTG 4 cut(s) 228, 414, 756, 833
MspI CCGG 3 cut(s) 92, 143, 1001
MspR9I CCNGG 4 cut(s) 300, 546, 799, 1001
MvaI CCWGG 3 cut(s) 300, 546, 799
MwoI GCNNNNNNNGC 5 cut(s) 1103, 1115, 1178, 1199, 1226
NciI CCSGG 1 cut(s) 1001
NdeII GATC 8 cut(s) 37, 243, 359, 575, 673, 704, 1069, 1174
NlaIII CATG 5 cut(s) 313, 1064, 1076, 1118, 1210
NlaIV GGNNCC 3 cut(s) 116, 429, 1105
NsbI TGCGCA 1 cut(s) 1059
NsiI ATGCAT 1 cut(s) 411
NspI RCATGY 1 cut(s) 1118
PaeI GCATGC 1 cut(s) 1118
PagI TCATGA 2 cut(s) 1072, 1206
PasI CCCWGGG 1 cut(s) 798
PfeI GAWTC 5 cut(s) 515, 761, 859, 1271, 1301
PflMI CCANNNNNTGG 1 cut(s) 440
PfoI TCCNGGA 1 cut(s) 999
PkrI GCNGC 2 cut(s) 823, 1108
PleI GAGTC 7 cut(s) 144, 154, 538, 767, 1253, 1273, 1283
PpsI GAGTC 7 cut(s) 144, 154, 538, 767, 1253, 1273, 1283
Psp6I CCWGG 3 cut(s) 298, 544, 797
PspFI CCCAGC 1 cut(s) 118
PspGI CCWGG 3 cut(s) 298, 544, 797
PspN4I GGNNCC 3 cut(s) 116, 429, 1105
PspPI GGNCC 1 cut(s) 419
PsuI RGATCY 2 cut(s) 575, 1174
RsaI GTAC 1 cut(s) 960
RsaNI GTAC 1 cut(s) 959
RseI CAYNNNNRTG 4 cut(s) 228, 414, 756, 833
SaqAI TTAA 4 cut(s) 84, 101, 257, 387
SatI GCNGC 2 cut(s) 822, 1107
Sau3AI GATC 8 cut(s) 37, 243, 359, 575, 673, 704, 1069, 1174
Sau96I GGNCC 1 cut(s) 419
SchI GAGTC 7 cut(s) 145, 155, 539, 767, 1253, 1274, 1283
ScrFI CCNGG 4 cut(s) 300, 546, 799, 1001
SduI GDGCHC 1 cut(s) 317
SetI ASST 5 cut(s) 46, 129, 547, 646, 1231
SfaNI GCATC 6 cut(s) 418, 546, 649, 808, 920, 1106
SmiMI CAYNNNNRTG 4 cut(s) 228, 414, 756, 833
SmlI CTYRAG 1 cut(s) 176
SmoI CTYRAG 1 cut(s) 176
SphI GCATGC 1 cut(s) 1118
Sse9I AATT 4 cut(s) 338, 665, 735, 873
SsiI CCGC 3 cut(s) 489, 1107, 1214
SspI AATATT 1 cut(s) 991
SspMI CTAG 3 cut(s) 227, 573, 1178
StyD4I CCNGG 4 cut(s) 298, 544, 797, 999
StyI CCWWGG 1 cut(s) 812
TaaI ACNGT 2 cut(s) 596, 1310
TaqI TCGA 4 cut(s) 36, 268, 362, 484
TasI AATT 4 cut(s) 338, 665, 735, 873
TauI GCSGC 1 cut(s) 1109
TfiI GAWTC 5 cut(s) 515, 761, 859, 1271, 1301
Tru1I TTAA 4 cut(s) 84, 101, 257, 387
Tru9I TTAA 4 cut(s) 84, 101, 257, 387
TscAI CASTG 2 cut(s) 441, 1315
TseI GCWGC 1 cut(s) 821
TspDTI ATGAA 5 cut(s) 298, 333, 744, 774, 968
TspGWI ACGGA 1 cut(s) 148
TspRI CASTG 2 cut(s) 441, 1315
Van91I CCANNNNNTGG 1 cut(s) 440
VneI GTGCAC 1 cut(s) 313
XapI RAATTY 1 cut(s) 338
XbaI TCTAGA 2 cut(s) 226, 572
XceI RCATGY 1 cut(s) 1118
XcmI CCANNNNNNNNNTGG 1 cut(s) 461
XspI CTAG 3 cut(s) 227, 573, 1178
Zsp2I ATGCAT 1 cut(s) 411
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.