Rmu_sc0001634.1_g000030

Structure-specific nuclease with 5'-flap endonuclease and 5'-3' exonuclease activities involved in DNA replication and repair. During DNA replication, cleaves the 5'-overhanging flap structure that is generated by displacement synthesis when DNA polymerase encounters the 5'-end of a downstream Okazaki fragment. It enters the flap from the 5'-end and then tracks to cleave the flap base, leaving a nick for ligation. Also involved in the long patch base excision repair (LP-BER) pathway, by cleaving within the apurinic apyrimidinic (AP) site-terminated flap. Acts as a genome stabilization factor that prevents flaps from equilibrating into structurs that lead to duplications and deletions. Also possesses 5'-3' exonuclease activity on nicked or gapped double- stranded DNA, and exhibits RNase H activity. Also involved in replication and repair of rDNA and in repairing mitochondrial DNA

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001634.1
OG0005415
Physical Location & Seq
Forward (+)
175272 .. 181465
6194 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001634.1_g000030.1.cds

Sequence Viewer

Length: 1194 bp
atggctgatgattccgtttgggcagtgctgatcctgagaattcaggggcttaagggtttaacgaagctgttggcggacaatgccccaaagtgcatgaaagagcagaaattcgagagctattttggccgcaagattgccatcgatgccagcatgagcatttatcagttccttattgttgtgggaagaactgggactgagatgctcactaatgaggctggtgaagttactagtcatctccaaggcatgttttcgcggactattaggcttctggaagctgggattaagccggtctatgttttcgatgggaagcctccagagttgaaaagccaagagctggcaaagcgttactcaaagagagttgatgctactcaagatttggcgacggccgtagagtctggcaataaggaagacattgagaaattcagtaaacggacggtaaaggtgacaaagcagcacaatgaagactgcagaagacttttaaggctcatgggtgtacctgtaattgaggctccctcggaagcagaggcacagtgtgctgtactttgcaaggcaggaaaggtttatgctgtggcctcagaagacatggattccctaacatttggagctcctaaatttcttcgccatttgatggatcctagctcaagaaaaatcccagtcatggaatttgatgttgctaaggttttggaggagctaaatcttactatggatcaattcattgacttgtgcatactctctggatgtgattattgtgacagcattcgaggtattggaggtcagacagctttgaagctcatccgccaacatggctccatagagagtatactggagaacataaacaaagagaggtaccaaataccggataattggccatatcaagaggctaggcggctttttaaggaaccagttgctttaaccgatgacgagcaactggagcttaagtggattgctccagatgaagatgggctgatttcctttctggtgaatgaaaatggattcaatagtgacagggtgactaaggctatagaaaagattaaggcagccaagaacaagtcatcacagggcagacttgaatcattttttaagccaactgctaccacatctgtaccccttaaacggaaggaaacaccacaaagtactgctaaagaaactagtaacaaaaaggcaaagggcggtggtggcagaaagaagaaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03030 ko03410 ko03450 map03030 map03410 map03450
Pfam Domains
Protein Families
XPG_I XPG_N

Protein Analysis

397

Amino Acids

44.39

Weight (kDa)

8.84

Isoelectric Point (pI)

44.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 846
AccB1I GGYRCC 1 cut(s) 846
AccB7I CCANNNNNTGG 2 cut(s) 334, 628
AccI GTMKAC 1 cut(s) 820
AccII CGCG 1 cut(s) 253
AciI CCGC 6 cut(s) 74, 127, 253, 796, 886, 1170
AclWI GGATC 4 cut(s) 25, 626, 639, 714
AcoI YGGCCR 3 cut(s) 124, 384, 866
AcsI RAATTY 5 cut(s) 39, 107, 419, 611, 662
AdeI CACNNNGTG 1 cut(s) 533
AfaI GTAC 5 cut(s) 495, 540, 848, 1104, 1135
AfiI CCNNNNNNNGG 5 cut(s) 334, 628, 658, 856, 1113
AflII CTTAAG 2 cut(s) 50, 935
AgsI TTSAA 4 cut(s) 322, 787, 997, 1070
AhlI ACTAGT 2 cut(s) 227, 1148
Alw21I GWGCWC 1 cut(s) 607
AlwI GGATC 4 cut(s) 25, 626, 639, 714
AoxI GGCC 4 cut(s) 124, 384, 570, 866
ApeKI GCWGC 2 cut(s) 451, 1037
ApoI RAATTY 5 cut(s) 39, 107, 419, 611, 662
Asp718I GGTACC 1 cut(s) 846
AsuHPI GGTGA 4 cut(s) 230, 454, 991, 1021
BaeI ACNNNNGTAYC 2 cut(s) 1086, 1119
BalI TGGCCA 1 cut(s) 868
BamHI GGATCC 1 cut(s) 631
BanI GGYRCC 1 cut(s) 846
BanII GRGCYC 1 cut(s) 607
BbsI GAAGAC 4 cut(s) 414, 468, 478, 585
Bbv12I GWGCWC 1 cut(s) 607
BbvI GCAGC 2 cut(s) 463, 1049
BccI CCATC 4 cut(s) 146, 296, 622, 953
BceAI ACGGC 2 cut(s) 371, 399
BcuI ACTAGT 2 cut(s) 227, 1148
BfaI CTAG 4 cut(s) 228, 636, 882, 1149
BfmI CTRYAG 2 cut(s) 466, 1020
BfrI CTTAAG 2 cut(s) 50, 935
BglI GCCNNNNNGGC 1 cut(s) 804
BisI GCNGC 4 cut(s) 127, 452, 887, 1038
BlsI GCNGC 4 cut(s) 128, 453, 888, 1039
BmcAI AGTACT 1 cut(s) 1135
BmiI GGNNCC 5 cut(s) 510, 633, 808, 848, 900
BmrI ACTGGG 2 cut(s) 198, 647
BmsI GCATC 3 cut(s) 133, 189, 352
BmuI ACTGGG 2 cut(s) 198, 647
BpiI GAAGAC 4 cut(s) 414, 468, 478, 585
BplI GAGNNNNNCTC 2 cut(s) 497, 529
BpmI CTGGAG 4 cut(s) 297, 845, 933, 950
Bpu10I CCTNAGC 1 cut(s) 675
BpuEI CTTGAG 2 cut(s) 354, 625
Bsa29I ATCGAT 1 cut(s) 141
BsaBI GATNNNNATC 1 cut(s) 137
BsaJI CCNNGG 2 cut(s) 238, 513
BsaWI WCCGGW 1 cut(s) 856
BsaXI ACNNNNNCTCC 2 cut(s) 923, 953
Bsc4I CCNNNNNNNGG 5 cut(s) 334, 628, 658, 856, 1113
Bse118I RCCGGY 1 cut(s) 286
Bse1I ACTGG 5 cut(s) 193, 653, 828, 902, 933
Bse8I GATNNNNATC 1 cut(s) 137
BseCI ATCGAT 1 cut(s) 141
BseDI CCNNGG 2 cut(s) 238, 513
BseGI GGATG 2 cut(s) 743, 792
BseJI GATNNNNATC 1 cut(s) 137
BseLI CCNNNNNNNGG 5 cut(s) 334, 628, 658, 856, 1113
BseMII CTCAG 3 cut(s) 26, 186, 588
BseNI ACTGG 5 cut(s) 193, 653, 828, 902, 933
BseRI GAGGAG 1 cut(s) 701
BseX3I CGGCCG 1 cut(s) 384
BseXI GCAGC 2 cut(s) 463, 1049
BseYI CCCAGC 1 cut(s) 275
Bsh1236I CGCG 1 cut(s) 253
Bsh1285I CGRYCG 1 cut(s) 387
BshFI GGCC 4 cut(s) 126, 386, 572, 868
BshNI GGYRCC 1 cut(s) 846
BshVI ATCGAT 1 cut(s) 141
BsiEI CGRYCG 1 cut(s) 387
BsiHKAI GWGCWC 1 cut(s) 607
BsiSI CCGG 2 cut(s) 287, 857
BslFI GGGAC 1 cut(s) 205
BslI CCNNNNNNNGG 5 cut(s) 334, 628, 658, 856, 1113
BsmFI GGGAC 1 cut(s) 205
BsmI GAATGC 1 cut(s) 756
BsnI GGCC 4 cut(s) 126, 386, 572, 868
Bsp1286I GDGCHC 1 cut(s) 607
Bsp143I GATC 3 cut(s) 30, 631, 706
BspACI CCGC 6 cut(s) 74, 127, 253, 796, 886, 1170
BspANI GGCC 4 cut(s) 126, 386, 572, 868
BspCNI CTCAG 3 cut(s) 27, 187, 587
BspDI ATCGAT 1 cut(s) 141
BspFNI CGCG 1 cut(s) 253
BspLI GGNNCC 5 cut(s) 510, 633, 808, 848, 900
BspMAI CTGCAG 1 cut(s) 470
BspPI GGATC 4 cut(s) 25, 626, 639, 714
BspT107I GGYRCC 1 cut(s) 846
BspTI CTTAAG 2 cut(s) 50, 935
BsrFI RCCGGY 1 cut(s) 286
BsrI ACTGG 5 cut(s) 193, 653, 828, 902, 933
BssAI RCCGGY 1 cut(s) 286
BssECI CCNNGG 2 cut(s) 238, 513
BssMI GATC 3 cut(s) 30, 631, 706
BssNAI GTATAC 1 cut(s) 821
BssT1I CCWWGG 1 cut(s) 238
Bst1107I GTATAC 1 cut(s) 821
Bst4CI ACNGT 2 cut(s) 436, 531
BstAFI CTTAAG 2 cut(s) 50, 935
BstAPI GCANNNNNTGC 1 cut(s) 533
BstC8I GCNNGC 2 cut(s) 148, 336
BstDEI CTNAG 5 cut(s) 35, 195, 574, 675, 1014
BstF5I GGATG 2 cut(s) 743, 792
BstFNI CGCG 1 cut(s) 253
BstKTI GATC 3 cut(s) 33, 634, 709
BstMBI GATC 3 cut(s) 30, 631, 706
BstMCI CGRYCG 1 cut(s) 387
BstMWI GCNNNNNNNGC 8 cut(s) 80, 123, 143, 340, 533, 804, 931, 1176
BstNSI RCATGY 1 cut(s) 247
BstSFI CTRYAG 2 cut(s) 466, 1020
BstUI CGCG 1 cut(s) 253
BstV1I GCAGC 2 cut(s) 463, 1049
BstV2I GAAGAC 4 cut(s) 414, 468, 478, 585
BstX2I RGATCY 1 cut(s) 631
BstYI RGATCY 1 cut(s) 631
BstZ17I GTATAC 1 cut(s) 821
BstZI CGGCCG 1 cut(s) 384
Bsu15I ATCGAT 1 cut(s) 141
BsuRI GGCC 4 cut(s) 126, 386, 572, 868
BsuTUI ATCGAT 1 cut(s) 141
BtsCI GGATG 2 cut(s) 743, 792
BtsI GCAGTG 1 cut(s) 30
BtsIMutI CAGTG 2 cut(s) 30, 536
Cac8I GCNNGC 2 cut(s) 148, 336
Cfr10I RCCGGY 1 cut(s) 286
ClaI ATCGAT 1 cut(s) 141
Csp6I GTAC 5 cut(s) 494, 539, 847, 1103, 1134
CviAII CATG 7 cut(s) 94, 151, 244, 487, 583, 658, 803
CviQI GTAC 5 cut(s) 494, 539, 847, 1103, 1134
DdeI CTNAG 5 cut(s) 35, 195, 574, 675, 1014
DpnI GATC 3 cut(s) 32, 633, 708
DpnII GATC 3 cut(s) 30, 631, 706
DraIII CACNNNGTG 1 cut(s) 533
EaeI YGGCCR 3 cut(s) 124, 384, 866
EagI CGGCCG 1 cut(s) 384
EciI GGCGGA 2 cut(s) 89, 785
Ecl136II GAGCTC 1 cut(s) 605
EclXI CGGCCG 1 cut(s) 384
Eco130I CCWWGG 1 cut(s) 238
Eco24I GRGCYC 1 cut(s) 607
Eco52I CGGCCG 1 cut(s) 384
Eco53kI GAGCTC 1 cut(s) 605
EcoICRI GAGCTC 1 cut(s) 605
EcoRI GAATTC 1 cut(s) 39
EcoT14I CCWWGG 1 cut(s) 238
EcoT38I GRGCYC 1 cut(s) 607
ErhI CCWWGG 1 cut(s) 238
FaeI CATG 7 cut(s) 97, 154, 247, 490, 586, 661, 806
FaqI GGGAC 1 cut(s) 205
FatI CATG 7 cut(s) 93, 150, 243, 486, 582, 657, 802
FblI GTMKAC 1 cut(s) 820
Fnu4HI GCNGC 4 cut(s) 127, 452, 887, 1038
FokI GGATG 2 cut(s) 750, 779
FriOI GRGCYC 1 cut(s) 607
Fsp4HI GCNGC 4 cut(s) 127, 452, 887, 1038
FspBI CTAG 4 cut(s) 228, 636, 882, 1149
GluI GCNGC 4 cut(s) 127, 452, 887, 1038
GsaI CCCAGC 1 cut(s) 279
GsuI CTGGAG 4 cut(s) 297, 845, 933, 950
HaeIII GGCC 4 cut(s) 126, 386, 572, 868
HapII CCGG 2 cut(s) 287, 857
Hin1II CATG 7 cut(s) 97, 154, 247, 490, 586, 661, 806
HinfI GANTC 5 cut(s) 11, 392, 587, 993, 1070
HpaII CCGG 2 cut(s) 287, 857
HphI GGTGA 4 cut(s) 230, 454, 991, 1021
Hpy166II GTNNAC 3 cut(s) 428, 494, 821
Hpy188I TCNGA 3 cut(s) 517, 577, 777
Hpy188III TCNNGA 9 cut(s) 34, 112, 269, 314, 371, 642, 735, 875, 950
Hpy8I GTNNAC 3 cut(s) 428, 494, 821
Hpy99I CGWCG 1 cut(s) 385
HpyAV CCTTC 1 cut(s) 1111
HpyCH4III ACNGT 2 cut(s) 436, 531
HpyCH4V TGCA 4 cut(s) 93, 468, 546, 726
HpyF10VI GCNNNNNNNGC 8 cut(s) 80, 123, 143, 340, 533, 804, 931, 1176
HpyF3I CTNAG 5 cut(s) 35, 195, 574, 675, 1014
Hsp92II CATG 7 cut(s) 97, 154, 247, 490, 586, 661, 806
KpnI GGTACC 1 cut(s) 850
Kzo9I GATC 3 cut(s) 30, 631, 706
LmnI GCTCC 7 cut(s) 514, 602, 610, 688, 812, 931, 952
Lsp1109I GCAGC 2 cut(s) 463, 1049
LweI GCATC 3 cut(s) 133, 189, 352
MaeI CTAG 4 cut(s) 228, 636, 882, 1149
MaeIII GTNAC 7 cut(s) 223, 344, 442, 749, 1001, 1009, 1151
MalI GATC 3 cut(s) 32, 633, 708
MboI GATC 3 cut(s) 30, 631, 706
MboII GAAGA 7 cut(s) 195, 419, 473, 483, 590, 608, 968
MflI RGATCY 1 cut(s) 631
MhlI GDGCHC 1 cut(s) 607
MlsI TGGCCA 1 cut(s) 868
MluCI AATT 8 cut(s) 39, 107, 419, 501, 611, 662, 710, 862
MluNI TGGCCA 1 cut(s) 868
MlyI GAGTC 1 cut(s) 401
Mox20I TGGCCA 1 cut(s) 868
MscI TGGCCA 1 cut(s) 868
Msp20I TGGCCA 1 cut(s) 868
MspCI CTTAAG 2 cut(s) 50, 935
MspI CCGG 2 cut(s) 287, 857
Mva1269I GAATGC 1 cut(s) 756
MvnI CGCG 1 cut(s) 253
MwoI GCNNNNNNNGC 8 cut(s) 80, 123, 143, 340, 533, 804, 931, 1176
NdeII GATC 3 cut(s) 30, 631, 706
NlaIII CATG 7 cut(s) 97, 154, 247, 490, 586, 661, 806
NlaIV GGNNCC 5 cut(s) 510, 633, 808, 848, 900
NmuCI GTSAC 4 cut(s) 442, 749, 1001, 1009
NspI RCATGY 1 cut(s) 247
PctI GAATGC 1 cut(s) 756
PfeI GAWTC 4 cut(s) 11, 587, 993, 1070
PflMI CCANNNNNTGG 2 cut(s) 334, 628
PkrI GCNGC 4 cut(s) 128, 453, 888, 1039
PleI GAGTC 1 cut(s) 400
PpsI GAGTC 1 cut(s) 400
Psp124BI GAGCTC 1 cut(s) 607
PspFI CCCAGC 1 cut(s) 275
PspN4I GGNNCC 5 cut(s) 510, 633, 808, 848, 900
PstI CTGCAG 1 cut(s) 470
PsuI RGATCY 1 cut(s) 631
RsaI GTAC 5 cut(s) 495, 540, 848, 1104, 1135
RsaNI GTAC 5 cut(s) 494, 539, 847, 1103, 1134
SacI GAGCTC 1 cut(s) 607
SatI GCNGC 4 cut(s) 127, 452, 887, 1038
Sau3AI GATC 3 cut(s) 30, 631, 706
ScaI AGTACT 1 cut(s) 1135
SchI GAGTC 1 cut(s) 401
SduI GDGCHC 1 cut(s) 607
SfaNI GCATC 3 cut(s) 133, 189, 352
SfcI CTRYAG 2 cut(s) 466, 1020
SmlI CTYRAG 4 cut(s) 50, 369, 640, 935
SmoI CTYRAG 4 cut(s) 50, 369, 640, 935
SpeI ACTAGT 2 cut(s) 227, 1148
Sse9I AATT 8 cut(s) 39, 107, 419, 501, 611, 662, 710, 862
SsiI CCGC 6 cut(s) 74, 127, 253, 796, 886, 1170
SspMI CTAG 4 cut(s) 228, 636, 882, 1149
SstI GAGCTC 1 cut(s) 607
StyI CCWWGG 1 cut(s) 238
TaaI ACNGT 2 cut(s) 436, 531
TaqI TCGA 4 cut(s) 111, 141, 300, 760
TasI AATT 8 cut(s) 39, 107, 419, 501, 611, 662, 710, 862
TatI WGTACW 2 cut(s) 538, 1133
TauI GCSGC 2 cut(s) 129, 889
TfiI GAWTC 4 cut(s) 11, 587, 993, 1070
TscAI CASTG 2 cut(s) 30, 536
TseFI GTSAC 4 cut(s) 442, 749, 1001, 1009
TseI GCWGC 2 cut(s) 451, 1037
Tsp45I GTSAC 4 cut(s) 442, 749, 1001, 1009
TspDTI ATGAA 5 cut(s) 110, 474, 703, 969, 999
TspGWI ACGGA 3 cut(s) 4, 445, 1129
TspRI CASTG 2 cut(s) 30, 536
Van91I CCANNNNNTGG 2 cut(s) 334, 628
Vha464I CTTAAG 2 cut(s) 50, 935
XapI RAATTY 5 cut(s) 39, 107, 419, 611, 662
XceI RCATGY 1 cut(s) 247
XmiI GTMKAC 1 cut(s) 820
XspI CTAG 4 cut(s) 228, 636, 882, 1149
ZrmI AGTACT 1 cut(s) 1135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.