Rorug03G0031900

Structure-specific nuclease with 5'-flap endonuclease and 5'-3' exonuclease activities involved in DNA replication and repair. During DNA replication, cleaves the 5'-overhanging flap structure that is generated by displacement synthesis when DNA polymerase encounters the 5'-end of a downstream Okazaki fragment. It enters the flap from the 5'-end and then tracks to cleave the flap base, leaving a nick for ligation. Also involved in the long patch base excision repair (LP-BER) pathway, by cleaving within the apurinic apyrimidinic (AP) site-terminated flap. Acts as a genome stabilization factor that prevents flaps from equilibrating into structurs that lead to duplications and deletions. Also possesses 5'-3' exonuclease activity on nicked or gapped double- stranded DNA, and exhibits RNase H activity. Also involved in replication and repair of rDNA and in repairing mitochondrial DNA

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
2522210 .. 2525207
2998 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0031900.1

Sequence Viewer

Length: 534 bp
ATGTCTGCGGAATCAGCCAGCGCAATTCAGAGAAGCCAAGTTGATCTGATGGACTTCATAGATTGGTCTGGGGTTGAATGCCTCAACCAAAGCACCAGTCACTCTGTTGCTAACGCTCTTAAGCAGGGATACAGAGACGATGATGGTTTGAATCTAGAGAGTGATGCGGATGAGCAGCTTCTGATCTACATTCCTTTTCTTCAAGTCATTAAGCTGCACTCTATTGTCATCAAAGGACCTGAAGAGGAAGGTCCCAAGACAGTGAAGCTTTTTTCAAACAAGGAGCACATGGGTTTCAGCAATGTCAATGACTACCCGGCAAGTGACACAGTTGTTTTATCGCCTGATCATCTAAAGGGAAAACCAGTTGTTTTGAAGTATGTCAAATTTCAAAATGTTCGCAGCTTGACAATTTTCATTGAGGATAATCAGTCTGACTCAGAAATCACAAAAGTTCAAAAGATTGGCCTGGTTGGAACAACGGTGGAAACAACTGACATGAAGGGTTTGAAGAAGATTGAGGATGGACACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

177

Amino Acids

19.64

Weight (kDa)

4.97

Isoelectric Point (pI)

40.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PITH PF06201 8 - 173 4.5e-54 PITH domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 8, 167
AcsI RAATTY 1 cut(s) 386
AcuI CTGAAG 1 cut(s) 261
AflII CTTAAG 1 cut(s) 119
AgsI TTSAA 8 cut(s) 77, 151, 203, 276, 376, 392, 458, 511
AjnI CCWGG 1 cut(s) 468
AluBI AGCT 4 cut(s) 178, 214, 268, 405
AluI AGCT 4 cut(s) 178, 214, 268, 405
Alw21I GWGCWC 1 cut(s) 288
Alw26I GTCTC 1 cut(s) 129
AlwNI CAGNNNCTG 1 cut(s) 181
AoxI GGCC 1 cut(s) 466
ApeKI GCWGC 3 cut(s) 175, 214, 402
ApoI RAATTY 1 cut(s) 386
ArsI GACNNNNNNTTYG 2 cut(s) 82, 114
AspLEI GCGC 1 cut(s) 23
AspS9I GGNCC 2 cut(s) 236, 251
AsuC2I CCSGG 1 cut(s) 317
AvaII GGWCC 2 cut(s) 236, 251
Bbv12I GWGCWC 1 cut(s) 288
BbvI GCAGC 3 cut(s) 187, 201, 414
BccI CCATC 3 cut(s) 43, 137, 518
BciT130I CCWGG 1 cut(s) 470
BciVI GTATCC 1 cut(s) 122
BclI TGATCA 1 cut(s) 346
BcnI CCSGG 1 cut(s) 317
BcoDI GTCTC 1 cut(s) 129
BfaI CTAG 1 cut(s) 155
BfrI CTTAAG 1 cut(s) 119
BfuI GTATCC 1 cut(s) 122
BisI GCNGC 3 cut(s) 176, 215, 403
BlsI GCNGC 3 cut(s) 177, 216, 404
Bme1390I CCNGG 2 cut(s) 317, 470
Bme18I GGWCC 2 cut(s) 236, 251
BmgT120I GGNCC 2 cut(s) 236, 251
BmiI GGNNCC 1 cut(s) 253
BmrFI CCNGG 2 cut(s) 317, 470
BmsI GCATC 1 cut(s) 154
BpuMI CCSGG 1 cut(s) 317
Bse1I ACTGG 2 cut(s) 96, 365
Bse3DI GCAATG 1 cut(s) 307
BseBI CCWGG 1 cut(s) 470
BseGI GGATG 2 cut(s) 175, 529
BseMI GCAATG 1 cut(s) 307
BseMII CTCAG 1 cut(s) 453
BseNI ACTGG 2 cut(s) 96, 365
BseXI GCAGC 3 cut(s) 187, 201, 414
BsgI GTGCAG 1 cut(s) 200
BshFI GGCC 1 cut(s) 468
BsiHKAI GWGCWC 1 cut(s) 288
BsiSI CCGG 1 cut(s) 317
BslFI GGGAC 1 cut(s) 237
BsmAI GTCTC 1 cut(s) 129
BsmBI CGTCTC 1 cut(s) 129
BsmFI GGGAC 1 cut(s) 237
BsmI GAATGC 1 cut(s) 83
BsnI GGCC 1 cut(s) 468
Bsp1286I GDGCHC 1 cut(s) 288
Bsp143I GATC 3 cut(s) 43, 183, 346
BspACI CCGC 2 cut(s) 8, 167
BspANI GGCC 1 cut(s) 468
BspCNI CTCAG 1 cut(s) 452
BspLI GGNNCC 1 cut(s) 253
BspTI CTTAAG 1 cut(s) 119
BsrDI GCAATG 1 cut(s) 307
BsrI ACTGG 2 cut(s) 96, 365
BssMI GATC 3 cut(s) 43, 183, 346
Bst2UI CCWGG 1 cut(s) 470
Bst4CI ACNGT 3 cut(s) 262, 331, 484
Bst6I CTCTTC 1 cut(s) 237
BstAFI CTTAAG 1 cut(s) 119
BstC8I GCNNGC 1 cut(s) 19
BstDEI CTNAG 1 cut(s) 439
BstF5I GGATG 2 cut(s) 175, 529
BstHHI GCGC 1 cut(s) 23
BstKTI GATC 3 cut(s) 46, 186, 349
BstMAI GTCTC 1 cut(s) 129
BstMBI GATC 3 cut(s) 43, 183, 346
BstMWI GCNNNNNNNGC 1 cut(s) 14
BstNI CCWGG 1 cut(s) 470
BstSCI CCNGG 2 cut(s) 315, 468
BstV1I GCAGC 3 cut(s) 187, 201, 414
BsuI GTATCC 1 cut(s) 122
BsuRI GGCC 1 cut(s) 468
BtsCI GGATG 2 cut(s) 175, 529
BtsIMutI CAGTG 2 cut(s) 267, 529
Cac8I GCNNGC 1 cut(s) 19
CaiI CAGNNNCTG 1 cut(s) 181
CfoI GCGC 1 cut(s) 23
Cfr13I GGNCC 2 cut(s) 236, 251
CviAII CATG 2 cut(s) 289, 499
CviJI RGCY 7 cut(s) 17, 36, 178, 214, 268, 405, 468
CviKI_1 RGCY 7 cut(s) 17, 36, 178, 214, 268, 405, 468
DdeI CTNAG 1 cut(s) 439
DpnI GATC 3 cut(s) 45, 185, 348
DpnII GATC 3 cut(s) 43, 183, 346
Eam1104I CTCTTC 1 cut(s) 237
EarI CTCTTC 1 cut(s) 237
Eco47I GGWCC 2 cut(s) 236, 251
Eco57I CTGAAG 1 cut(s) 261
EcoO109I RGGNCCY 2 cut(s) 236, 251
EcoRII CCWGG 1 cut(s) 468
Esp3I CGTCTC 1 cut(s) 129
FaeI CATG 2 cut(s) 292, 502
FaiI YATR 4 cut(s) 59, 290, 381, 500
FaqI GGGAC 1 cut(s) 237
FatI CATG 2 cut(s) 288, 498
FbaI TGATCA 1 cut(s) 346
Fnu4HI GCNGC 3 cut(s) 176, 215, 403
FokI GGATG 1 cut(s) 182
Fsp4HI GCNGC 3 cut(s) 176, 215, 403
FspBI CTAG 1 cut(s) 155
GlaI GCGC 1 cut(s) 22
GluI GCNGC 3 cut(s) 176, 215, 403
HaeIII GGCC 1 cut(s) 468
HapII CCGG 1 cut(s) 317
HhaI GCGC 1 cut(s) 23
Hin1II CATG 2 cut(s) 292, 502
Hin6I GCGC 1 cut(s) 21
HinP1I GCGC 1 cut(s) 21
HindIII AAGCTT 1 cut(s) 266
HinfI GANTC 3 cut(s) 11, 151, 437
HpaII CCGG 1 cut(s) 317
Hpy188I TCNGA 5 cut(s) 30, 48, 183, 436, 442
Hpy188III TCNNGA 1 cut(s) 155
HpyAV CCTTC 2 cut(s) 242, 496
HpyCH4III ACNGT 3 cut(s) 262, 331, 484
HpyCH4V TGCA 1 cut(s) 217
HpyF10VI GCNNNNNNNGC 1 cut(s) 14
HpyF3I CTNAG 1 cut(s) 439
Hsp92II CATG 2 cut(s) 292, 502
HspAI GCGC 1 cut(s) 21
Ksp22I TGATCA 1 cut(s) 346
Kzo9I GATC 3 cut(s) 43, 183, 346
LmnI GCTCC 1 cut(s) 283
Lsp1109I GCAGC 3 cut(s) 187, 201, 414
LweI GCATC 1 cut(s) 154
MaeI CTAG 1 cut(s) 155
MaeIII GTNAC 2 cut(s) 98, 323
MalI GATC 3 cut(s) 45, 185, 348
MboI GATC 3 cut(s) 43, 183, 346
MboII GAAGA 4 cut(s) 191, 254, 523, 526
MhlI GDGCHC 1 cut(s) 288
MluCI AATT 3 cut(s) 24, 386, 411
MlyI GAGTC 1 cut(s) 431
MmeI TCCRAC 1 cut(s) 454
MnlI CCTC 4 cut(s) 92, 238, 415, 514
MseI TTAA 2 cut(s) 120, 210
MspCI CTTAAG 1 cut(s) 119
MspI CCGG 1 cut(s) 317
MspR9I CCNGG 2 cut(s) 317, 470
Mva1269I GAATGC 1 cut(s) 83
MvaI CCWGG 1 cut(s) 470
MwoI GCNNNNNNNGC 1 cut(s) 14
NciI CCSGG 1 cut(s) 317
NdeII GATC 3 cut(s) 43, 183, 346
NlaIII CATG 2 cut(s) 292, 502
NlaIV GGNNCC 1 cut(s) 253
NmuCI GTSAC 2 cut(s) 98, 323
PctI GAATGC 1 cut(s) 83
PfeI GAWTC 2 cut(s) 11, 151
PkrI GCNGC 3 cut(s) 177, 216, 404
PleI GAGTC 1 cut(s) 431
PpsI GAGTC 1 cut(s) 431
PpuMI RGGWCCY 2 cut(s) 236, 251
Psp5II RGGWCCY 2 cut(s) 236, 251
Psp6I CCWGG 1 cut(s) 468
PspGI CCWGG 1 cut(s) 468
PspN4I GGNNCC 1 cut(s) 253
PspPI GGNCC 2 cut(s) 236, 251
PspPPI RGGWCCY 2 cut(s) 236, 251
PstNI CAGNNNCTG 1 cut(s) 181
SaqAI TTAA 2 cut(s) 120, 210
SatI GCNGC 3 cut(s) 176, 215, 403
Sau3AI GATC 3 cut(s) 43, 183, 346
Sau96I GGNCC 2 cut(s) 236, 251
SchI GAGTC 1 cut(s) 431
ScrFI CCNGG 2 cut(s) 317, 470
SduI GDGCHC 1 cut(s) 288
SetI ASST 6 cut(s) 180, 216, 241, 253, 270, 407
SfaNI GCATC 1 cut(s) 154
SinI GGWCC 2 cut(s) 236, 251
SmlI CTYRAG 1 cut(s) 119
SmoI CTYRAG 1 cut(s) 119
Sse9I AATT 3 cut(s) 24, 386, 411
SsiI CCGC 2 cut(s) 8, 167
SspMI CTAG 1 cut(s) 155
StyD4I CCNGG 2 cut(s) 315, 468
TaaI ACNGT 3 cut(s) 262, 331, 484
TasI AATT 3 cut(s) 24, 386, 411
TfiI GAWTC 2 cut(s) 11, 151
Tru1I TTAA 2 cut(s) 120, 210
Tru9I TTAA 2 cut(s) 120, 210
TscAI CASTG 1 cut(s) 267
TseFI GTSAC 2 cut(s) 98, 323
TseI GCWGC 3 cut(s) 175, 214, 402
Tsp45I GTSAC 2 cut(s) 98, 323
TspDTI ATGAA 3 cut(s) 46, 406, 515
TspRI CASTG 1 cut(s) 267
Vha464I CTTAAG 1 cut(s) 119
VpaK11BI GGWCC 2 cut(s) 236, 251
XapI RAATTY 1 cut(s) 386
XbaI TCTAGA 1 cut(s) 154
XspI CTAG 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.