Rmu_sc0016560.1_g000001

Structure-specific nuclease with 5'-flap endonuclease and 5'-3' exonuclease activities involved in DNA replication and repair. During DNA replication, cleaves the 5'-overhanging flap structure that is generated by displacement synthesis when DNA polymerase encounters the 5'-end of a downstream Okazaki fragment. It enters the flap from the 5'-end and then tracks to cleave the flap base, leaving a nick for ligation. Also involved in the long patch base excision repair (LP-BER) pathway, by cleaving within the apurinic apyrimidinic (AP) site-terminated flap. Acts as a genome stabilization factor that prevents flaps from equilibrating into structurs that lead to duplications and deletions. Also possesses 5'-3' exonuclease activity on nicked or gapped double- stranded DNA, and exhibits RNase H activity. Also involved in replication and repair of rDNA and in repairing mitochondrial DNA

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016560.1
OG0005415
Physical Location & Seq
Forward (+)
1 .. 6638
6638 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016560.1_g000001.1.cds

Sequence Viewer

Length: 1246 bp
gcgggaagcagtttcatccctaacctcaaacccaaagctttctcctttctcactcttcatattactcctcttcctcttctctttgctacatctaatgggtataaagggtttaacgaagctgttggcggacaatgccccaaagtgcatgaaagagcagaaattcgagagctattttggccgcaagattgccatcgatgccagcatgagcatttatcagttccttattgttgtgggaagaactgggactgagatgctcactaatgaggctggtgaagttactagtcatctccaaggcatgttttcgcggactattaggcttctggaagctgggattaagccggtctatgttttcgatgggaagcctccagagttgaaaagccaagagctggcaaagcgttactcaaagagagttgatgctactcaagatttggcgacggccgtagagtctggcaataaggaagacattgagaaattcagtaaacggacggtaaaggtgacaaagcagcacaatgaagactgcagaagacttttaaggctcatgggtgtacctgtaattgaggctccctcggaagcagaggcacagtgtgctgtactttgcaaggcaggaaaggtttatgctgtggcctcagaagacatggattccctaacatttggagctcctaaatttcttcgccatttgatggatcctagctcaagaaaaatcccagtcatggaatttgatgttgctaaggttttggaggagctaaatcttactatggatcaattcattgacttgtgcatactctctggatgtgattattgtgacagcattcgaggtattggaggtcagacagctttgaagctcatccgccaacatggctccatagagagtatactggagaacataaacaaagagaggtaccaaataccggataattggccatatcaagaggctaggcggctttttaaggaaccagttgctttaaccgatgacgagcaactggagcttaagtggattgctccagatgaagatgggctgatttcctttctggtgaatgaaaatggattcaatagtgacagggtgactaaggctatagaaaagattaaggcagccaagaacaagtcatcacagggcagacttgaatcattttttaagccaactgctaccacatctgtaccccttaaacggaaggaaacaccacaaagtactgctaaagaaactagtaacaaaaaggcaaagggcggtggtggcagaaagaagaaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03030 ko03410 ko03450 map03030 map03410 map03450
Pfam Domains
Protein Families
XPG_I XPG_N

Protein Analysis

414

Amino Acids

46.29

Weight (kDa)

9.0

Isoelectric Point (pI)

44.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 898
AccB1I GGYRCC 1 cut(s) 898
AccB7I CCANNNNNTGG 2 cut(s) 386, 680
AccI GTMKAC 1 cut(s) 872
AccII CGCG 1 cut(s) 305
AciI CCGC 7 cut(s) 2, 126, 179, 305, 848, 938, 1222
AclWI GGATC 3 cut(s) 678, 691, 766
AcoI YGGCCR 3 cut(s) 176, 436, 918
AcsI RAATTY 4 cut(s) 159, 471, 663, 714
AdeI CACNNNGTG 1 cut(s) 585
AfaI GTAC 5 cut(s) 547, 592, 900, 1156, 1187
AfiI CCNNNNNNNGG 5 cut(s) 386, 680, 710, 908, 1165
AflII CTTAAG 1 cut(s) 987
AgsI TTSAA 4 cut(s) 374, 839, 1049, 1122
AhlI ACTAGT 2 cut(s) 279, 1200
Alw21I GWGCWC 1 cut(s) 659
AlwI GGATC 3 cut(s) 678, 691, 766
AoxI GGCC 4 cut(s) 176, 436, 622, 918
ApeKI GCWGC 2 cut(s) 503, 1089
ApoI RAATTY 4 cut(s) 159, 471, 663, 714
Asp718I GGTACC 1 cut(s) 898
AsuHPI GGTGA 4 cut(s) 282, 506, 1043, 1073
BaeI ACNNNNGTAYC 2 cut(s) 1138, 1171
BalI TGGCCA 1 cut(s) 920
BamHI GGATCC 1 cut(s) 683
BanI GGYRCC 1 cut(s) 898
BanII GRGCYC 1 cut(s) 659
BbsI GAAGAC 4 cut(s) 466, 520, 530, 637
Bbv12I GWGCWC 1 cut(s) 659
BbvI GCAGC 2 cut(s) 515, 1101
BccI CCATC 4 cut(s) 198, 348, 674, 1005
BceAI ACGGC 2 cut(s) 423, 451
BcuI ACTAGT 2 cut(s) 279, 1200
BfaI CTAG 4 cut(s) 280, 688, 934, 1201
BfmI CTRYAG 2 cut(s) 518, 1072
BfrI CTTAAG 1 cut(s) 987
BglI GCCNNNNNGGC 1 cut(s) 856
BisI GCNGC 4 cut(s) 179, 504, 939, 1090
BlsI GCNGC 4 cut(s) 180, 505, 940, 1091
BmcAI AGTACT 1 cut(s) 1187
BmiI GGNNCC 5 cut(s) 562, 685, 860, 900, 952
BmrI ACTGGG 2 cut(s) 250, 699
BmsI GCATC 3 cut(s) 185, 241, 404
BmuI ACTGGG 2 cut(s) 250, 699
BpiI GAAGAC 4 cut(s) 466, 520, 530, 637
BplI GAGNNNNNCTC 2 cut(s) 549, 581
BpmI CTGGAG 4 cut(s) 349, 897, 985, 1002
Bpu10I CCTNAGC 1 cut(s) 727
BpuEI CTTGAG 2 cut(s) 406, 677
Bsa29I ATCGAT 1 cut(s) 193
BsaBI GATNNNNATC 1 cut(s) 189
BsaJI CCNNGG 2 cut(s) 290, 565
BsaWI WCCGGW 1 cut(s) 908
BsaXI ACNNNNNCTCC 2 cut(s) 975, 1005
Bsc4I CCNNNNNNNGG 5 cut(s) 386, 680, 710, 908, 1165
Bse118I RCCGGY 1 cut(s) 338
Bse1I ACTGG 5 cut(s) 245, 705, 880, 954, 985
Bse8I GATNNNNATC 1 cut(s) 189
BseCI ATCGAT 1 cut(s) 193
BseDI CCNNGG 2 cut(s) 290, 565
BseGI GGATG 3 cut(s) 15, 795, 844
BseJI GATNNNNATC 1 cut(s) 189
BseLI CCNNNNNNNGG 5 cut(s) 386, 680, 710, 908, 1165
BseMII CTCAG 2 cut(s) 238, 640
BseNI ACTGG 5 cut(s) 245, 705, 880, 954, 985
BseRI GAGGAG 2 cut(s) 57, 753
BseX3I CGGCCG 1 cut(s) 436
BseXI GCAGC 2 cut(s) 515, 1101
BseYI CCCAGC 1 cut(s) 327
Bsh1236I CGCG 1 cut(s) 305
Bsh1285I CGRYCG 1 cut(s) 439
BshFI GGCC 4 cut(s) 178, 438, 624, 920
BshNI GGYRCC 1 cut(s) 898
BshVI ATCGAT 1 cut(s) 193
BsiEI CGRYCG 1 cut(s) 439
BsiHKAI GWGCWC 1 cut(s) 659
BsiSI CCGG 2 cut(s) 339, 909
BslFI GGGAC 1 cut(s) 257
BslI CCNNNNNNNGG 5 cut(s) 386, 680, 710, 908, 1165
BsmFI GGGAC 1 cut(s) 257
BsmI GAATGC 1 cut(s) 808
BsnI GGCC 4 cut(s) 178, 438, 624, 920
Bsp1286I GDGCHC 1 cut(s) 659
Bsp143I GATC 2 cut(s) 683, 758
BspACI CCGC 7 cut(s) 2, 126, 179, 305, 848, 938, 1222
BspANI GGCC 4 cut(s) 178, 438, 624, 920
BspCNI CTCAG 2 cut(s) 239, 639
BspDI ATCGAT 1 cut(s) 193
BspFNI CGCG 1 cut(s) 305
BspLI GGNNCC 5 cut(s) 562, 685, 860, 900, 952
BspMAI CTGCAG 1 cut(s) 522
BspPI GGATC 3 cut(s) 678, 691, 766
BspT107I GGYRCC 1 cut(s) 898
BspTI CTTAAG 1 cut(s) 987
BsrFI RCCGGY 1 cut(s) 338
BsrI ACTGG 5 cut(s) 245, 705, 880, 954, 985
BssAI RCCGGY 1 cut(s) 338
BssECI CCNNGG 2 cut(s) 290, 565
BssMI GATC 2 cut(s) 683, 758
BssNAI GTATAC 1 cut(s) 873
BssT1I CCWWGG 1 cut(s) 290
Bst1107I GTATAC 1 cut(s) 873
Bst4CI ACNGT 2 cut(s) 488, 583
Bst6I CTCTTC 3 cut(s) 60, 75, 81
BstAFI CTTAAG 1 cut(s) 987
BstAPI GCANNNNNTGC 1 cut(s) 585
BstC8I GCNNGC 2 cut(s) 200, 388
BstDEI CTNAG 4 cut(s) 247, 626, 727, 1066
BstF5I GGATG 3 cut(s) 15, 795, 844
BstFNI CGCG 1 cut(s) 305
BstKTI GATC 2 cut(s) 686, 761
BstMBI GATC 2 cut(s) 683, 758
BstMCI CGRYCG 1 cut(s) 439
BstMWI GCNNNNNNNGC 8 cut(s) 132, 175, 195, 392, 585, 856, 983, 1228
BstNSI RCATGY 1 cut(s) 299
BstSFI CTRYAG 2 cut(s) 518, 1072
BstUI CGCG 1 cut(s) 305
BstV1I GCAGC 2 cut(s) 515, 1101
BstV2I GAAGAC 4 cut(s) 466, 520, 530, 637
BstX2I RGATCY 1 cut(s) 683
BstYI RGATCY 1 cut(s) 683
BstZ17I GTATAC 1 cut(s) 873
BstZI CGGCCG 1 cut(s) 436
Bsu15I ATCGAT 1 cut(s) 193
BsuRI GGCC 4 cut(s) 178, 438, 624, 920
BsuTUI ATCGAT 1 cut(s) 193
BtsCI GGATG 3 cut(s) 15, 795, 844
BtsIMutI CAGTG 1 cut(s) 588
Cac8I GCNNGC 2 cut(s) 200, 388
Cfr10I RCCGGY 1 cut(s) 338
ClaI ATCGAT 1 cut(s) 193
Csp6I GTAC 5 cut(s) 546, 591, 899, 1155, 1186
CviAII CATG 7 cut(s) 146, 203, 296, 539, 635, 710, 855
CviQI GTAC 5 cut(s) 546, 591, 899, 1155, 1186
DdeI CTNAG 4 cut(s) 247, 626, 727, 1066
DpnI GATC 2 cut(s) 685, 760
DpnII GATC 2 cut(s) 683, 758
DraIII CACNNNGTG 1 cut(s) 585
EaeI YGGCCR 3 cut(s) 176, 436, 918
EagI CGGCCG 1 cut(s) 436
Eam1104I CTCTTC 3 cut(s) 60, 75, 81
EarI CTCTTC 3 cut(s) 60, 75, 81
EciI GGCGGA 2 cut(s) 141, 837
Ecl136II GAGCTC 1 cut(s) 657
EclXI CGGCCG 1 cut(s) 436
Eco130I CCWWGG 1 cut(s) 290
Eco24I GRGCYC 1 cut(s) 659
Eco52I CGGCCG 1 cut(s) 436
Eco53kI GAGCTC 1 cut(s) 657
EcoICRI GAGCTC 1 cut(s) 657
EcoT14I CCWWGG 1 cut(s) 290
EcoT38I GRGCYC 1 cut(s) 659
ErhI CCWWGG 1 cut(s) 290
FaeI CATG 7 cut(s) 149, 206, 299, 542, 638, 713, 858
FaqI GGGAC 1 cut(s) 257
FatI CATG 7 cut(s) 145, 202, 295, 538, 634, 709, 854
FblI GTMKAC 1 cut(s) 872
Fnu4HI GCNGC 4 cut(s) 179, 504, 939, 1090
FokI GGATG 3 cut(s) 2, 802, 831
FriOI GRGCYC 1 cut(s) 659
Fsp4HI GCNGC 4 cut(s) 179, 504, 939, 1090
FspBI CTAG 4 cut(s) 280, 688, 934, 1201
GluI GCNGC 4 cut(s) 179, 504, 939, 1090
GsaI CCCAGC 1 cut(s) 331
GsuI CTGGAG 4 cut(s) 349, 897, 985, 1002
HaeIII GGCC 4 cut(s) 178, 438, 624, 920
HapII CCGG 2 cut(s) 339, 909
Hin1II CATG 7 cut(s) 149, 206, 299, 542, 638, 713, 858
HindIII AAGCTT 1 cut(s) 36
HinfI GANTC 4 cut(s) 444, 639, 1045, 1122
HpaII CCGG 2 cut(s) 339, 909
HphI GGTGA 4 cut(s) 282, 506, 1043, 1073
Hpy166II GTNNAC 3 cut(s) 480, 546, 873
Hpy188I TCNGA 3 cut(s) 569, 629, 829
Hpy188III TCNNGA 8 cut(s) 164, 321, 366, 423, 694, 787, 927, 1002
Hpy8I GTNNAC 3 cut(s) 480, 546, 873
Hpy99I CGWCG 1 cut(s) 437
HpyAV CCTTC 1 cut(s) 1163
HpyCH4III ACNGT 2 cut(s) 488, 583
HpyCH4V TGCA 4 cut(s) 145, 520, 598, 778
HpyF10VI GCNNNNNNNGC 8 cut(s) 132, 175, 195, 392, 585, 856, 983, 1228
HpyF3I CTNAG 4 cut(s) 247, 626, 727, 1066
Hsp92II CATG 7 cut(s) 149, 206, 299, 542, 638, 713, 858
KpnI GGTACC 1 cut(s) 902
Kzo9I GATC 2 cut(s) 683, 758
LmnI GCTCC 7 cut(s) 566, 654, 662, 740, 864, 983, 1004
Lsp1109I GCAGC 2 cut(s) 515, 1101
LweI GCATC 3 cut(s) 185, 241, 404
MaeI CTAG 4 cut(s) 280, 688, 934, 1201
MaeIII GTNAC 7 cut(s) 275, 396, 494, 801, 1053, 1061, 1203
MalI GATC 2 cut(s) 685, 760
MboI GATC 2 cut(s) 683, 758
MflI RGATCY 1 cut(s) 683
MhlI GDGCHC 1 cut(s) 659
MlsI TGGCCA 1 cut(s) 920
MluCI AATT 7 cut(s) 159, 471, 553, 663, 714, 762, 914
MluNI TGGCCA 1 cut(s) 920
MlyI GAGTC 1 cut(s) 453
Mox20I TGGCCA 1 cut(s) 920
MscI TGGCCA 1 cut(s) 920
MseI TTAA 9 cut(s) 111, 334, 531, 946, 963, 988, 1084, 1132, 1162
Msp20I TGGCCA 1 cut(s) 920
MspCI CTTAAG 1 cut(s) 987
MspI CCGG 2 cut(s) 339, 909
Mva1269I GAATGC 1 cut(s) 808
MvnI CGCG 1 cut(s) 305
MwoI GCNNNNNNNGC 8 cut(s) 132, 175, 195, 392, 585, 856, 983, 1228
NdeII GATC 2 cut(s) 683, 758
NlaIII CATG 7 cut(s) 149, 206, 299, 542, 638, 713, 858
NlaIV GGNNCC 5 cut(s) 562, 685, 860, 900, 952
NmuCI GTSAC 4 cut(s) 494, 801, 1053, 1061
NspI RCATGY 1 cut(s) 299
PctI GAATGC 1 cut(s) 808
PfeI GAWTC 3 cut(s) 639, 1045, 1122
PflMI CCANNNNNTGG 2 cut(s) 386, 680
PkrI GCNGC 4 cut(s) 180, 505, 940, 1091
PleI GAGTC 1 cut(s) 452
PpsI GAGTC 1 cut(s) 452
Psp124BI GAGCTC 1 cut(s) 659
PspFI CCCAGC 1 cut(s) 327
PspN4I GGNNCC 5 cut(s) 562, 685, 860, 900, 952
PstI CTGCAG 1 cut(s) 522
PsuI RGATCY 1 cut(s) 683
RsaI GTAC 5 cut(s) 547, 592, 900, 1156, 1187
RsaNI GTAC 5 cut(s) 546, 591, 899, 1155, 1186
SacI GAGCTC 1 cut(s) 659
SaqAI TTAA 9 cut(s) 111, 334, 531, 946, 963, 988, 1084, 1132, 1162
SatI GCNGC 4 cut(s) 179, 504, 939, 1090
Sau3AI GATC 2 cut(s) 683, 758
ScaI AGTACT 1 cut(s) 1187
SchI GAGTC 1 cut(s) 453
SduI GDGCHC 1 cut(s) 659
SfaNI GCATC 3 cut(s) 185, 241, 404
SfcI CTRYAG 2 cut(s) 518, 1072
SmlI CTYRAG 3 cut(s) 421, 692, 987
SmoI CTYRAG 3 cut(s) 421, 692, 987
SpeI ACTAGT 2 cut(s) 279, 1200
Sse9I AATT 7 cut(s) 159, 471, 553, 663, 714, 762, 914
SsiI CCGC 7 cut(s) 2, 126, 179, 305, 848, 938, 1222
SspMI CTAG 4 cut(s) 280, 688, 934, 1201
SstI GAGCTC 1 cut(s) 659
StyI CCWWGG 1 cut(s) 290
TaaI ACNGT 2 cut(s) 488, 583
TaqI TCGA 4 cut(s) 163, 193, 352, 812
TasI AATT 7 cut(s) 159, 471, 553, 663, 714, 762, 914
TatI WGTACW 2 cut(s) 590, 1185
TauI GCSGC 2 cut(s) 181, 941
TfiI GAWTC 3 cut(s) 639, 1045, 1122
Tru1I TTAA 9 cut(s) 111, 334, 531, 946, 963, 988, 1084, 1132, 1162
Tru9I TTAA 9 cut(s) 111, 334, 531, 946, 963, 988, 1084, 1132, 1162
TscAI CASTG 1 cut(s) 588
TseFI GTSAC 4 cut(s) 494, 801, 1053, 1061
TseI GCWGC 2 cut(s) 503, 1089
Tsp45I GTSAC 4 cut(s) 494, 801, 1053, 1061
TspDTI ATGAA 7 cut(s) 4, 47, 162, 526, 755, 1021, 1051
TspGWI ACGGA 2 cut(s) 497, 1181
TspRI CASTG 1 cut(s) 588
Van91I CCANNNNNTGG 2 cut(s) 386, 680
Vha464I CTTAAG 1 cut(s) 987
XapI RAATTY 4 cut(s) 159, 471, 663, 714
XceI RCATGY 1 cut(s) 299
XmiI GTMKAC 1 cut(s) 872
XspI CTAG 4 cut(s) 280, 688, 934, 1201
ZrmI AGTACT 1 cut(s) 1187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.