Rmu_sc0022983.1_g000002

Structure-specific nuclease with 5'-flap endonuclease and 5'-3' exonuclease activities involved in DNA replication and repair. During DNA replication, cleaves the 5'-overhanging flap structure that is generated by displacement synthesis when DNA polymerase encounters the 5'-end of a downstream Okazaki fragment. It enters the flap from the 5'-end and then tracks to cleave the flap base, leaving a nick for ligation. Also involved in the long patch base excision repair (LP-BER) pathway, by cleaving within the apurinic apyrimidinic (AP) site-terminated flap. Acts as a genome stabilization factor that prevents flaps from equilibrating into structurs that lead to duplications and deletions. Also possesses 5'-3' exonuclease activity on nicked or gapped double- stranded DNA, and exhibits RNase H activity. Also involved in replication and repair of rDNA and in repairing mitochondrial DNA

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0022983.1
OG0005415
Physical Location & Seq
Reverse (-)
3285 .. 8937
5653 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0022983.1_g000002.1.cds

Sequence Viewer

Length: 1152 bp
atgggtataaagggtttaacgaagctgttggcggacaatgccccaaagtgcatgaaagagcagaaattcgagagctattttggccgcaagattgccatcgatgccagcatgagcatttatcagttccttattgttgtgggaagaactgggactgagatgctcactaatgaggctggtgaagttactagtcatctccaaggcatgttttcgcggactattaggcttctggaagctgggattaagccggtctatgttttcgatgggaagcctccagagttgaaaagccaagagctggcaaagcgttactcaaagagagttgatgctactcaagatttggcgacggccgtagagtctggcaataaggaagacattgagaaattcagtaaacggacggtaaaggtgacaaagcagcacaatgaagactgcagaagacttttaaggctcatgggtgtacctgtaattgaggctccctcggaagcagaggcacagtgtgctgtactttgcaaggcaggaaaggtttatgctgtggcctcagaagacatggattccctaacatttggagctcctaaatttcttcgccatttgatggatcctagctcaagaaaaatcccagtcatggaatttgatgttgctaaggttttggaggagctaaatcttactatggatcaattcattgacttgtgcatactctctggatgtgattattgtgacagcattcgaggtattggaggtcagacagctttgaagctcatccgccaacatggctccatagagagtatactggagaacataaacaaagagaggtaccaaataccggataattggccatatcaagaggctaggcggctttttaaggaaccagttgctttaaccgatgacgagcaactggagcttaagtggattgctccagatgaagatgggctgatttcctttctggtgaatgaaaatggattcaatagtgacagggtgactaaggctatagaaaagattaaggcagccaagaacaagtcatcacagggcagacttgaatcattttttaagccaactgctaccacatctgtaccccttaaacggaaggaaacaccacaaagtactgctaaagaaactagtaacaaaaaggcaaagggcggtggtggcagaaagaagaaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03030 ko03410 ko03450 map03030 map03410 map03450
Pfam Domains
Protein Families
XPG_I XPG_N

Protein Analysis

383

Amino Acids

42.81

Weight (kDa)

8.93

Isoelectric Point (pI)

44.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 804
AccB1I GGYRCC 1 cut(s) 804
AccB7I CCANNNNNTGG 2 cut(s) 292, 586
AccI GTMKAC 1 cut(s) 778
AccII CGCG 1 cut(s) 211
AciI CCGC 6 cut(s) 32, 85, 211, 754, 844, 1128
AclWI GGATC 3 cut(s) 584, 597, 672
AcoI YGGCCR 3 cut(s) 82, 342, 824
AcsI RAATTY 4 cut(s) 65, 377, 569, 620
AdeI CACNNNGTG 1 cut(s) 491
AfaI GTAC 5 cut(s) 453, 498, 806, 1062, 1093
AfiI CCNNNNNNNGG 5 cut(s) 292, 586, 616, 814, 1071
AflII CTTAAG 1 cut(s) 893
AgsI TTSAA 4 cut(s) 280, 745, 955, 1028
AhlI ACTAGT 2 cut(s) 185, 1106
Alw21I GWGCWC 1 cut(s) 565
AlwI GGATC 3 cut(s) 584, 597, 672
AoxI GGCC 4 cut(s) 82, 342, 528, 824
ApeKI GCWGC 2 cut(s) 409, 995
ApoI RAATTY 4 cut(s) 65, 377, 569, 620
Asp718I GGTACC 1 cut(s) 804
AsuHPI GGTGA 4 cut(s) 188, 412, 949, 979
BaeI ACNNNNGTAYC 2 cut(s) 1044, 1077
BalI TGGCCA 1 cut(s) 826
BamHI GGATCC 1 cut(s) 589
BanI GGYRCC 1 cut(s) 804
BanII GRGCYC 1 cut(s) 565
BbsI GAAGAC 4 cut(s) 372, 426, 436, 543
Bbv12I GWGCWC 1 cut(s) 565
BbvI GCAGC 2 cut(s) 421, 1007
BccI CCATC 4 cut(s) 104, 254, 580, 911
BceAI ACGGC 2 cut(s) 329, 357
BcuI ACTAGT 2 cut(s) 185, 1106
BfaI CTAG 4 cut(s) 186, 594, 840, 1107
BfmI CTRYAG 2 cut(s) 424, 978
BfrI CTTAAG 1 cut(s) 893
BglI GCCNNNNNGGC 1 cut(s) 762
BisI GCNGC 4 cut(s) 85, 410, 845, 996
BlsI GCNGC 4 cut(s) 86, 411, 846, 997
BmcAI AGTACT 1 cut(s) 1093
BmiI GGNNCC 5 cut(s) 468, 591, 766, 806, 858
BmrI ACTGGG 2 cut(s) 156, 605
BmsI GCATC 3 cut(s) 91, 147, 310
BmuI ACTGGG 2 cut(s) 156, 605
BpiI GAAGAC 4 cut(s) 372, 426, 436, 543
BplI GAGNNNNNCTC 2 cut(s) 455, 487
BpmI CTGGAG 4 cut(s) 255, 803, 891, 908
Bpu10I CCTNAGC 1 cut(s) 633
BpuEI CTTGAG 2 cut(s) 312, 583
Bsa29I ATCGAT 1 cut(s) 99
BsaBI GATNNNNATC 1 cut(s) 95
BsaJI CCNNGG 2 cut(s) 196, 471
BsaWI WCCGGW 1 cut(s) 814
BsaXI ACNNNNNCTCC 2 cut(s) 881, 911
Bsc4I CCNNNNNNNGG 5 cut(s) 292, 586, 616, 814, 1071
Bse118I RCCGGY 1 cut(s) 244
Bse1I ACTGG 5 cut(s) 151, 611, 786, 860, 891
Bse8I GATNNNNATC 1 cut(s) 95
BseCI ATCGAT 1 cut(s) 99
BseDI CCNNGG 2 cut(s) 196, 471
BseGI GGATG 2 cut(s) 701, 750
BseJI GATNNNNATC 1 cut(s) 95
BseLI CCNNNNNNNGG 5 cut(s) 292, 586, 616, 814, 1071
BseMII CTCAG 2 cut(s) 144, 546
BseNI ACTGG 5 cut(s) 151, 611, 786, 860, 891
BseRI GAGGAG 1 cut(s) 659
BseX3I CGGCCG 1 cut(s) 342
BseXI GCAGC 2 cut(s) 421, 1007
BseYI CCCAGC 1 cut(s) 233
Bsh1236I CGCG 1 cut(s) 211
Bsh1285I CGRYCG 1 cut(s) 345
BshFI GGCC 4 cut(s) 84, 344, 530, 826
BshNI GGYRCC 1 cut(s) 804
BshVI ATCGAT 1 cut(s) 99
BsiEI CGRYCG 1 cut(s) 345
BsiHKAI GWGCWC 1 cut(s) 565
BsiSI CCGG 2 cut(s) 245, 815
BslFI GGGAC 1 cut(s) 163
BslI CCNNNNNNNGG 5 cut(s) 292, 586, 616, 814, 1071
BsmFI GGGAC 1 cut(s) 163
BsmI GAATGC 1 cut(s) 714
BsnI GGCC 4 cut(s) 84, 344, 530, 826
Bsp1286I GDGCHC 1 cut(s) 565
Bsp143I GATC 2 cut(s) 589, 664
BspACI CCGC 6 cut(s) 32, 85, 211, 754, 844, 1128
BspANI GGCC 4 cut(s) 84, 344, 530, 826
BspCNI CTCAG 2 cut(s) 145, 545
BspDI ATCGAT 1 cut(s) 99
BspFNI CGCG 1 cut(s) 211
BspLI GGNNCC 5 cut(s) 468, 591, 766, 806, 858
BspMAI CTGCAG 1 cut(s) 428
BspPI GGATC 3 cut(s) 584, 597, 672
BspT107I GGYRCC 1 cut(s) 804
BspTI CTTAAG 1 cut(s) 893
BsrFI RCCGGY 1 cut(s) 244
BsrI ACTGG 5 cut(s) 151, 611, 786, 860, 891
BssAI RCCGGY 1 cut(s) 244
BssECI CCNNGG 2 cut(s) 196, 471
BssMI GATC 2 cut(s) 589, 664
BssNAI GTATAC 1 cut(s) 779
BssT1I CCWWGG 1 cut(s) 196
Bst1107I GTATAC 1 cut(s) 779
Bst4CI ACNGT 2 cut(s) 394, 489
BstAFI CTTAAG 1 cut(s) 893
BstAPI GCANNNNNTGC 1 cut(s) 491
BstC8I GCNNGC 2 cut(s) 106, 294
BstDEI CTNAG 4 cut(s) 153, 532, 633, 972
BstF5I GGATG 2 cut(s) 701, 750
BstFNI CGCG 1 cut(s) 211
BstKTI GATC 2 cut(s) 592, 667
BstMBI GATC 2 cut(s) 589, 664
BstMCI CGRYCG 1 cut(s) 345
BstMWI GCNNNNNNNGC 8 cut(s) 38, 81, 101, 298, 491, 762, 889, 1134
BstNSI RCATGY 1 cut(s) 205
BstSFI CTRYAG 2 cut(s) 424, 978
BstUI CGCG 1 cut(s) 211
BstV1I GCAGC 2 cut(s) 421, 1007
BstV2I GAAGAC 4 cut(s) 372, 426, 436, 543
BstX2I RGATCY 1 cut(s) 589
BstYI RGATCY 1 cut(s) 589
BstZ17I GTATAC 1 cut(s) 779
BstZI CGGCCG 1 cut(s) 342
Bsu15I ATCGAT 1 cut(s) 99
BsuRI GGCC 4 cut(s) 84, 344, 530, 826
BsuTUI ATCGAT 1 cut(s) 99
BtsCI GGATG 2 cut(s) 701, 750
BtsIMutI CAGTG 1 cut(s) 494
Cac8I GCNNGC 2 cut(s) 106, 294
Cfr10I RCCGGY 1 cut(s) 244
ClaI ATCGAT 1 cut(s) 99
Csp6I GTAC 5 cut(s) 452, 497, 805, 1061, 1092
CviAII CATG 7 cut(s) 52, 109, 202, 445, 541, 616, 761
CviQI GTAC 5 cut(s) 452, 497, 805, 1061, 1092
DdeI CTNAG 4 cut(s) 153, 532, 633, 972
DpnI GATC 2 cut(s) 591, 666
DpnII GATC 2 cut(s) 589, 664
DraIII CACNNNGTG 1 cut(s) 491
EaeI YGGCCR 3 cut(s) 82, 342, 824
EagI CGGCCG 1 cut(s) 342
EciI GGCGGA 2 cut(s) 47, 743
Ecl136II GAGCTC 1 cut(s) 563
EclXI CGGCCG 1 cut(s) 342
Eco130I CCWWGG 1 cut(s) 196
Eco24I GRGCYC 1 cut(s) 565
Eco52I CGGCCG 1 cut(s) 342
Eco53kI GAGCTC 1 cut(s) 563
EcoICRI GAGCTC 1 cut(s) 563
EcoT14I CCWWGG 1 cut(s) 196
EcoT38I GRGCYC 1 cut(s) 565
ErhI CCWWGG 1 cut(s) 196
FaeI CATG 7 cut(s) 55, 112, 205, 448, 544, 619, 764
FaqI GGGAC 1 cut(s) 163
FatI CATG 7 cut(s) 51, 108, 201, 444, 540, 615, 760
FblI GTMKAC 1 cut(s) 778
Fnu4HI GCNGC 4 cut(s) 85, 410, 845, 996
FokI GGATG 2 cut(s) 708, 737
FriOI GRGCYC 1 cut(s) 565
Fsp4HI GCNGC 4 cut(s) 85, 410, 845, 996
FspBI CTAG 4 cut(s) 186, 594, 840, 1107
GluI GCNGC 4 cut(s) 85, 410, 845, 996
GsaI CCCAGC 1 cut(s) 237
GsuI CTGGAG 4 cut(s) 255, 803, 891, 908
HaeIII GGCC 4 cut(s) 84, 344, 530, 826
HapII CCGG 2 cut(s) 245, 815
Hin1II CATG 7 cut(s) 55, 112, 205, 448, 544, 619, 764
HinfI GANTC 4 cut(s) 350, 545, 951, 1028
HpaII CCGG 2 cut(s) 245, 815
HphI GGTGA 4 cut(s) 188, 412, 949, 979
Hpy166II GTNNAC 3 cut(s) 386, 452, 779
Hpy188I TCNGA 3 cut(s) 475, 535, 735
Hpy188III TCNNGA 8 cut(s) 70, 227, 272, 329, 600, 693, 833, 908
Hpy8I GTNNAC 3 cut(s) 386, 452, 779
Hpy99I CGWCG 1 cut(s) 343
HpyAV CCTTC 1 cut(s) 1069
HpyCH4III ACNGT 2 cut(s) 394, 489
HpyCH4V TGCA 4 cut(s) 51, 426, 504, 684
HpyF10VI GCNNNNNNNGC 8 cut(s) 38, 81, 101, 298, 491, 762, 889, 1134
HpyF3I CTNAG 4 cut(s) 153, 532, 633, 972
Hsp92II CATG 7 cut(s) 55, 112, 205, 448, 544, 619, 764
KpnI GGTACC 1 cut(s) 808
Kzo9I GATC 2 cut(s) 589, 664
LmnI GCTCC 7 cut(s) 472, 560, 568, 646, 770, 889, 910
Lsp1109I GCAGC 2 cut(s) 421, 1007
LweI GCATC 3 cut(s) 91, 147, 310
MaeI CTAG 4 cut(s) 186, 594, 840, 1107
MaeIII GTNAC 7 cut(s) 181, 302, 400, 707, 959, 967, 1109
MalI GATC 2 cut(s) 591, 666
MboI GATC 2 cut(s) 589, 664
MboII GAAGA 7 cut(s) 153, 377, 431, 441, 548, 566, 926
MflI RGATCY 1 cut(s) 589
MhlI GDGCHC 1 cut(s) 565
MlsI TGGCCA 1 cut(s) 826
MluCI AATT 7 cut(s) 65, 377, 459, 569, 620, 668, 820
MluNI TGGCCA 1 cut(s) 826
MlyI GAGTC 1 cut(s) 359
Mox20I TGGCCA 1 cut(s) 826
MscI TGGCCA 1 cut(s) 826
MseI TTAA 9 cut(s) 17, 240, 437, 852, 869, 894, 990, 1038, 1068
Msp20I TGGCCA 1 cut(s) 826
MspCI CTTAAG 1 cut(s) 893
MspI CCGG 2 cut(s) 245, 815
Mva1269I GAATGC 1 cut(s) 714
MvnI CGCG 1 cut(s) 211
MwoI GCNNNNNNNGC 8 cut(s) 38, 81, 101, 298, 491, 762, 889, 1134
NdeII GATC 2 cut(s) 589, 664
NlaIII CATG 7 cut(s) 55, 112, 205, 448, 544, 619, 764
NlaIV GGNNCC 5 cut(s) 468, 591, 766, 806, 858
NmuCI GTSAC 4 cut(s) 400, 707, 959, 967
NspI RCATGY 1 cut(s) 205
PctI GAATGC 1 cut(s) 714
PfeI GAWTC 3 cut(s) 545, 951, 1028
PflMI CCANNNNNTGG 2 cut(s) 292, 586
PkrI GCNGC 4 cut(s) 86, 411, 846, 997
PleI GAGTC 1 cut(s) 358
PpsI GAGTC 1 cut(s) 358
Psp124BI GAGCTC 1 cut(s) 565
PspFI CCCAGC 1 cut(s) 233
PspN4I GGNNCC 5 cut(s) 468, 591, 766, 806, 858
PstI CTGCAG 1 cut(s) 428
PsuI RGATCY 1 cut(s) 589
RsaI GTAC 5 cut(s) 453, 498, 806, 1062, 1093
RsaNI GTAC 5 cut(s) 452, 497, 805, 1061, 1092
SacI GAGCTC 1 cut(s) 565
SaqAI TTAA 9 cut(s) 17, 240, 437, 852, 869, 894, 990, 1038, 1068
SatI GCNGC 4 cut(s) 85, 410, 845, 996
Sau3AI GATC 2 cut(s) 589, 664
ScaI AGTACT 1 cut(s) 1093
SchI GAGTC 1 cut(s) 359
SduI GDGCHC 1 cut(s) 565
SfaNI GCATC 3 cut(s) 91, 147, 310
SfcI CTRYAG 2 cut(s) 424, 978
SmlI CTYRAG 3 cut(s) 327, 598, 893
SmoI CTYRAG 3 cut(s) 327, 598, 893
SpeI ACTAGT 2 cut(s) 185, 1106
Sse9I AATT 7 cut(s) 65, 377, 459, 569, 620, 668, 820
SsiI CCGC 6 cut(s) 32, 85, 211, 754, 844, 1128
SspMI CTAG 4 cut(s) 186, 594, 840, 1107
SstI GAGCTC 1 cut(s) 565
StyI CCWWGG 1 cut(s) 196
TaaI ACNGT 2 cut(s) 394, 489
TaqI TCGA 4 cut(s) 69, 99, 258, 718
TasI AATT 7 cut(s) 65, 377, 459, 569, 620, 668, 820
TatI WGTACW 2 cut(s) 496, 1091
TauI GCSGC 2 cut(s) 87, 847
TfiI GAWTC 3 cut(s) 545, 951, 1028
Tru1I TTAA 9 cut(s) 17, 240, 437, 852, 869, 894, 990, 1038, 1068
Tru9I TTAA 9 cut(s) 17, 240, 437, 852, 869, 894, 990, 1038, 1068
TscAI CASTG 1 cut(s) 494
TseFI GTSAC 4 cut(s) 400, 707, 959, 967
TseI GCWGC 2 cut(s) 409, 995
Tsp45I GTSAC 4 cut(s) 400, 707, 959, 967
TspDTI ATGAA 5 cut(s) 68, 432, 661, 927, 957
TspGWI ACGGA 2 cut(s) 403, 1087
TspRI CASTG 1 cut(s) 494
Van91I CCANNNNNTGG 2 cut(s) 292, 586
Vha464I CTTAAG 1 cut(s) 893
XapI RAATTY 4 cut(s) 65, 377, 569, 620
XceI RCATGY 1 cut(s) 205
XmiI GTMKAC 1 cut(s) 778
XspI CTAG 4 cut(s) 186, 594, 840, 1107
ZrmI AGTACT 1 cut(s) 1093
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.