Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002026.1

Orthogroup ID

OG0006981

Physical Location & Seq

Genomic Coordinates Forward (+)

191531 .. 199619

Gene Structure 8089 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002026.1_g000039.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 3135 bp

atggggggcacggagaaggctatcagccttgaggagatcaagaacgagactgttgatctggaaaggattcccattgaggaagtgtttgggcagctgaaatgttccagagaaggtctaagcggggcggaaggagcccagaggctcgagatttttggtcccaacaagctagaagagaagaaggaaagcaaatttctcaagttccttgggtttatgtggaaccctctatcatgggtcatggaagctgctgccattatggctattgctttggccaatggaagtggaaagcccccagattggcaagattttgtgggtattgtatgcttgttggtgatcaactccaccatcagtttcattgaagaaaacaatgcaggaaatgcagctgctgcacttatggctggtcttgctcccaagactaaggtgcttagagatggaaagtggtctgaggaggatgcttccatcctggttccaggagatatcattagcatcaagttgggagacattgtcccagctgatgctcgtcttcttgagggtgatcctttaaagattgatcaatctgcccttacgggagaatcacttccagtgaccaagcatccaggagatgaagttttctctggttcaacttgcaaacaaggtgaaatcgaagctgttgtcattgccactggtgtccacaccttctttgggaaggctgctcatcttgtagatagcaccaaccaagttggacatttccagaaggttctcactgctattggaaacttctgtatctgctccattgcagttggaatgttgattgagattgtagtcatgtatcccattcagcacagaaagtacagggacggaattaacaatctccttgtactcttgattggaggcattcccattgccatgcctaccgtcttgtctgtgacaatggctattggatctcacaggctctctcagcagggtgccatcaccaagagaatgaccgccattgaagaaatggctggtatggatgtgctttgcagtgacaagacaggaacactaactctcaacaagcttagtattgacaaaaacttgattgaggtctttgccaagggtacggagaaagaccatgtggttctgcttgctgcaagggcatctagaaccgaaaaccaggatgccattgatgctgccatggttggaatgcttgctgacccaaaggaggcccgtgctggcattcgagaaattcatttcttgccatttaatcctgtggacaagagaactgctttgacttacattgattctgatggaaactggcacagagcaagcaaaggtgcacctgagcagattttggacctctgcaagtgcaaagaggatttcaagaagaaggcttttgccattattgacaagtatgctgaacgtggtcttcggtctttggctgttgctagacaggaagtgcccgcaaaatcaaaagaaagtgagggcggtccatggcagttggttgggttgttgcctcttttcgatccaccaagacacgatagtgcagaaactatccgccaggctcttaatcttggtgtgaatgttaagatgattactggtgatcaacttgctattgcaaaggaaactggtcgcagacttggaatgggaacaaacatgtacccatctgcttccttacttggtcaagacaaggatgcaagcatagctgccctcccaatagaagagttaatcgagaaggctgacgggtttgctggagtgtttccagagcacaaatatgagattgtgaagaagttgcaggagagaaagcacatttgtggaatgacaggagatggtgtcaatgatgcccctgcattgaagaaggctgatattggaattgctgtcgcagatgctacagatgctgcacgaagtgcttccgacattgttcttacagaacccggattgagtgtcatcatcagtgcagtgttgaccagtagagctattttccagagaatgaagaactacacgatctatgcagtttccatcaccatccgtattgtgtttggtttcatgttcattgcactcatatggaagtttgacttctctcctttcatggttttgattattgccatattaaacgatggaacaattatgacaatctcaaaggacagagttgtaccatccccccttcccgatagctggaaattgaaagagatatttgctactgggattgtgctcggaggttacttggcattgatgaccgttatattcttctggttgatgaaagaaaccaacttcttttcggataaatttggtgtcagatctataagagagaatcccaaggaacaaatggctgctttgtacctacaagtcagtattgtgagccaggctctcatttttgtcactcgatcacgaagctggtcgtttttggaacgccctggactactattactcggtgcttttgccatcgcccagctggttgcaactttgatagcagtatatgccaactggggatttgcaacaatacatggatgcggttggggatgggccggtgtcatctggctttacagcattgtcttctatttcccactcgacattattaagtttgcaatccgatacatcttgagtggaaaggcatggctcaacatgctagagaacaagactgcctttaccaccaagaaagattatggaaaagaggagagggaagctcaatgggctcatgcacaaaggacccttcatggactgcaagcaccagaaagtagtactctgtttagtgacaagagcagctacagagagctgtctgagattgccgagcaggctaagagacgagcagagatggcaagacttcgtgagcttaccacactcaagggacatgtcgagtcagtggcgaagctgaaggggctggaccttgattcaatccagcagcattatacagtaaacagaggaatgcttgcacatggaggcatcggggcagcgccgatctcaagcaggggtggttgcttggcggttctgacttctgggtctccatcgctggcccaaaacattaggttttcgtactggtggaatgattggcaacgtttggtggcttcaagcaagcttggggctgctgggctggcttgcttcatatgggctagggatgggtcttttggacctaatacttggtccaagaggaagcaggctaccagggggcttgggcctaatatttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

ko00190 map00190

Pfam Domains

Protein Families

Cation_ATPase_N E1-E2_ATPase Hydrolase

Protein Analysis

1044

Amino Acids

114.25

Weight (kDa)

8.23

Isoelectric Point (pI)

35.78

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006981)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G18960 AT2G18960 AT2G18960 AT4G30190 AT4G30190 AT5G57350 AT5G57350 AT5G57350 AT5G57350
fragaria_vesca	FvH4_4g07810 FvH4_4g07810
malus_domestica	MD13G1247200.v1.1 MD16G1254200.v1.1
prunus_persica	Prupe.1G082000_v2.0.a1
pyrus_communis	pycom12g18290
rosa_chinensis	RchiOBHm_Chr4g0400911
rosa_laevigata	RLG00000009165
rosa_multiflora	Rmu_sc0002026.1_g000039
rosa_roxburghii	Rroxscaffold_5G00345810
rosa_rugosa	Rorug04G0027100
rosa_samantha	Rh4AG104700 Rh4BG099900 Rh4CG113100 Rh4DG096900
rosa_wichuraiana	Rw4G008480

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	2947
AccB1I	GGYRCC	1 cut(s)	941
AciI	CCGC	8 cut(s)	120, 125, 963, 1416, 1440, 1510, 2463, 2933
AclI	AACGTT	1 cut(s)	3004
AclWI	GGATC	3 cut(s)	527, 925, 1472
AcoI	YGGCCR	1 cut(s)	267
AcsI	RAATTY	3 cut(s)	188, 1200, 2237
AcuI	CTGAAG	1 cut(s)	2843
AdeI	CACNNNGTG	1 cut(s)	1859
AfaI	GTAC	8 cut(s)	827, 855, 1075, 1613, 2106, 2291, 2692, 2984
AfiI	CCNNNNNNNGG	4 cut(s)	294, 678, 1177, 2127
AflIII	ACRYGT	2 cut(s)	1608, 2800
AgsI	TTSAA	8 cut(s)	356, 618, 971, 1336, 1807, 2137, 2844, 3018
AjnI	CCWGG	8 cut(s)	459, 466, 592, 1128, 1512, 2313, 2365, 3110
AleI	CACNNNNGTG	2 cut(s)	1494, 1764
Alw21I	GWGCWC	3 cut(s)	1294, 1722, 2166
Alw26I	GTCTC	4 cut(s)	41, 489, 2746, 2955
Alw44I	GTGCAC	1 cut(s)	1290
AlwI	GGATC	3 cut(s)	527, 925, 1472
AlwNI	CAGNNNCTG	2 cut(s)	383, 1850
Ama87I	CYCGRG	1 cut(s)	143
AoxI	GGCC	5 cut(s)	267, 1179, 2475, 2961, 3122
ApaLI	GTGCAC	1 cut(s)	1290
ApoI	RAATTY	3 cut(s)	188, 1200, 2237
ArsI	GACNNNNNNTTYG	2 cut(s)	633, 665
Asp700I	GAANNNNTTC	3 cut(s)	66, 573, 1861
AspLEI	GCGC	1 cut(s)	2905
AsuC2I	CCSGG	1 cut(s)	1887
AsuHPI	GGTGA	6 cut(s)	340, 542, 644, 940, 1565, 1966
AvaI	CYCGRG	1 cut(s)	143
AvaII	GGWCC	7 cut(s)	155, 1309, 1442, 2658, 2833, 3077, 3090
BaeGI	GKGCMC	3 cut(s)	11, 1294, 1416
BaeI	ACNNNNGTAYC	2 cut(s)	742, 775
BalI	TGGCCA	1 cut(s)	269
BanI	GGYRCC	1 cut(s)	941
BanII	GRGCYC	2 cut(s)	136, 2647
BbsI	GAAGAC	3 cut(s)	512, 1373, 2497
Bbv12I	GWGCWC	3 cut(s)	1294, 1722, 2166
BciT130I	CCWGG	8 cut(s)	461, 468, 594, 1130, 1514, 2315, 2367, 3112
BciVI	GTATCC	1 cut(s)	816
BclI	TGATCA	3 cut(s)	330, 547, 1555
BcnI	CCSGG	1 cut(s)	1887
BcoDI	GTCTC	4 cut(s)	41, 489, 2746, 2955
BfaI	CTAG	5 cut(s)	167, 1116, 1401, 2579, 3060
BfmI	CTRYAG	2 cut(s)	1842, 2716
BfoI	RGCGCY	1 cut(s)	2906
BfuI	GTATCC	1 cut(s)	816
BglI	GCCNNNNNGGC	2 cut(s)	254, 2744
BglII	AGATCT	1 cut(s)	2249
BmcAI	AGTACT	1 cut(s)	2692
Bme1390I	CCNGG	9 cut(s)	461, 468, 594, 1130, 1514, 1887, 2315, 2367, 3112
Bme18I	GGWCC	7 cut(s)	155, 1309, 1442, 2658, 2833, 3077, 3090
BmeT110I	CYCGRG	1 cut(s)	143
BmiI	GGNNCC	6 cut(s)	133, 157, 218, 465, 943, 2660
BmrFI	CCNGG	9 cut(s)	461, 468, 594, 1130, 1514, 1887, 2315, 2367, 3112
BmrI	ACTGGG	2 cut(s)	2163, 2446
BmuI	ACTGGG	2 cut(s)	2163, 2446
BpiI	GAAGAC	3 cut(s)	512, 1373, 2497
BplI	GAGNNNNNCTC	4 cut(s)	2302, 2334, 2620, 2652
BpmI	CTGGAG	1 cut(s)	1725
Bpu10I	CCTNAGC	1 cut(s)	1296
BpuEI	CTTGAG	6 cut(s)	50, 179, 545, 2572, 2777, 2896
BpuMI	CCSGG	1 cut(s)	1887
BsaI	GGTCTC	1 cut(s)	2955
BsaJI	CCNNGG	7 cut(s)	202, 1068, 1149, 1445, 2268, 2365, 3111
BsaXI	ACNNNNNCTCC	6 cut(s)	486, 516, 588, 618, 1770, 1800
Bsc4I	CCNNNNNNNGG	4 cut(s)	294, 678, 1177, 2127
Bse118I	RCCGGY	1 cut(s)	2477
Bse1I	ACTGG	9 cut(s)	578, 664, 1274, 1555, 1585, 1920, 2158, 2441, 2990
Bse3DI	GCAATG	4 cut(s)	651, 768, 876, 2004
BseBI	CCWGG	8 cut(s)	461, 468, 594, 1130, 1514, 2315, 2367, 3112
BseDI	CCNNGG	7 cut(s)	202, 1068, 1149, 1445, 2268, 2365, 3111
BseLI	CCNNNNNNNGG	4 cut(s)	294, 678, 1177, 2127
BseMI	GCAATG	4 cut(s)	651, 768, 876, 2004
BseMII	CTCAG	4 cut(s)	432, 947, 1287, 2721
BseNI	ACTGG	9 cut(s)	578, 664, 1274, 1555, 1585, 1920, 2158, 2441, 2990
BseRI	GAGGAG	3 cut(s)	47, 458, 2639
BseSI	GKGCMC	3 cut(s)	11, 1294, 1416
BseYI	CCCAGC	3 cut(s)	505, 2400, 3035
BsgI	GTGCAG	4 cut(s)	369, 1518, 1836, 1929
BshFI	GGCC	5 cut(s)	269, 1181, 2477, 2963, 3124
BshNI	GGYRCC	1 cut(s)	941
BsiHKAI	GWGCWC	3 cut(s)	1294, 1722, 2166
BsiHKCI	CYCGRG	1 cut(s)	143
BsiSI	CCGG	2 cut(s)	1887, 2478
BslFI	GGGAC	4 cut(s)	141, 488, 845, 2811
BslI	CCNNNNNNNGG	4 cut(s)	294, 678, 1177, 2127
BsmAI	GTCTC	4 cut(s)	41, 489, 2746, 2955
BsmBI	CGTCTC	1 cut(s)	2746
BsmFI	GGGAC	4 cut(s)	141, 488, 845, 2811
BsmI	GAATGC	4 cut(s)	870, 1164, 1191, 2880
BsnI	GGCC	5 cut(s)	269, 1181, 2477, 2963, 3124
Bso31I	GGTCTC	1 cut(s)	2955
BsoBI	CYCGRG	1 cut(s)	143
Bsp1286I	GDGCHC	7 cut(s)	11, 136, 1294, 1416, 1722, 2166, 2647
Bsp19I	CCATGG	2 cut(s)	1149, 1445
BspACI	CCGC	8 cut(s)	120, 125, 963, 1416, 1440, 1510, 2463, 2933
BspANI	GGCC	5 cut(s)	269, 1181, 2477, 2963, 3124
BspCNI	CTCAG	4 cut(s)	433, 946, 1288, 2722
BspLI	GGNNCC	6 cut(s)	133, 157, 218, 465, 943, 2660
BspPI	GGATC	3 cut(s)	527, 925, 1472
BspT107I	GGYRCC	1 cut(s)	941
BspTNI	GGTCTC	1 cut(s)	2955
BsrDI	GCAATG	4 cut(s)	651, 768, 876, 2004
BsrFI	RCCGGY	1 cut(s)	2477
BsrI	ACTGG	9 cut(s)	578, 664, 1274, 1555, 1585, 1920, 2158, 2441, 2990
BssAI	RCCGGY	1 cut(s)	2477
BssECI	CCNNGG	7 cut(s)	202, 1068, 1149, 1445, 2268, 2365, 3111
BssT1I	CCWWGG	5 cut(s)	202, 1068, 1149, 1445, 2268
Bst2UI	CCWGG	8 cut(s)	461, 468, 594, 1130, 1514, 2315, 2367, 3112
Bst4CI	ACNGT	4 cut(s)	52, 892, 2191, 2863
Bst6I	CTCTTC	2 cut(s)	165, 1668
BstAPI	GCANNNNNTGC	4 cut(s)	374, 383, 1859, 2429
BstDEI	CTNAG	9 cut(s)	116, 414, 422, 441, 933, 1034, 1296, 2730, 2748
BstDSI	CCRYGG	2 cut(s)	1149, 1445
BstH2I	RGCGCY	1 cut(s)	2906
BstHHI	GCGC	1 cut(s)	2905
BstMAI	GTCTC	4 cut(s)	41, 489, 2746, 2955
BstNI	CCWGG	8 cut(s)	461, 468, 594, 1130, 1514, 2315, 2367, 3112
BstNSI	RCATGY	3 cut(s)	1612, 2578, 2804
BstSCI	CCNGG	9 cut(s)	459, 466, 592, 1128, 1512, 1885, 2313, 2365, 3110
BstSFI	CTRYAG	2 cut(s)	1842, 2716
BstSLI	GKGCMC	3 cut(s)	11, 1294, 1416
BstV2I	GAAGAC	3 cut(s)	512, 1373, 2497
BstX2I	RGATCY	2 cut(s)	917, 2249
BstYI	RGATCY	2 cut(s)	917, 2249
BsuI	GTATCC	1 cut(s)	816
BsuRI	GGCC	5 cut(s)	269, 1181, 2477, 2963, 3124
BtgI	CCRYGG	2 cut(s)	1149, 1445
BtgZI	GCGATG	2 cut(s)	2380, 2940
BtsI	GCAGTG	3 cut(s)	738, 1006, 1917
BtsIMutI	CAGTG	7 cut(s)	585, 657, 738, 1006, 1912, 1917, 2817
CaiI	CAGNNNCTG	2 cut(s)	383, 1850
CfoI	GCGC	1 cut(s)	2905
Cfr10I	RCCGGY	1 cut(s)	2477
Csp6I	GTAC	8 cut(s)	826, 854, 1074, 1612, 2105, 2290, 2691, 2983
CspCI	CAANNNNNGTGG	2 cut(s)	259, 294
CviQI	GTAC	8 cut(s)	826, 854, 1074, 1612, 2105, 2290, 2691, 2983
DdeI	CTNAG	9 cut(s)	116, 414, 422, 441, 933, 1034, 1296, 2730, 2748
DraI	TTTAAA	1 cut(s)	540
DraIII	CACNNNGTG	1 cut(s)	1859
DrdI	GACNNNNNNGTC	1 cut(s)	2947
DseDI	GACNNNNNNGTC	1 cut(s)	2947
EaeI	YGGCCR	1 cut(s)	267
Eam1104I	CTCTTC	2 cut(s)	165, 1668
EarI	CTCTTC	2 cut(s)	165, 1668
EciI	GGCGGA	2 cut(s)	140, 1499
Eco130I	CCWWGG	5 cut(s)	202, 1068, 1149, 1445, 2268
Eco24I	GRGCYC	2 cut(s)	136, 2647
Eco31I	GGTCTC	1 cut(s)	2955
Eco32I	GATATC	1 cut(s)	475
Eco47I	GGWCC	7 cut(s)	155, 1309, 1442, 2658, 2833, 3077, 3090
Eco57I	CTGAAG	1 cut(s)	2843
Eco88I	CYCGRG	1 cut(s)	143
EcoO109I	RGGNCCY	1 cut(s)	2658
EcoRII	CCWGG	8 cut(s)	459, 466, 592, 1128, 1512, 2313, 2365, 3110
EcoRV	GATATC	1 cut(s)	475
EcoT14I	CCWWGG	5 cut(s)	202, 1068, 1149, 1445, 2268
EcoT38I	GRGCYC	2 cut(s)	136, 2647
ErhI	CCWWGG	5 cut(s)	202, 1068, 1149, 1445, 2268
Esp3I	CGTCTC	1 cut(s)	2746
FalI	AAGNNNNNCTT	4 cut(s)	2012, 2044, 2579, 2611
FaqI	GGGAC	4 cut(s)	141, 488, 845, 2811
FauI	CCCGC	2 cut(s)	113, 1423
FauNDI	CATATG	2 cut(s)	2015, 3053
FbaI	TGATCA	3 cut(s)	330, 547, 1555
FriOI	GRGCYC	2 cut(s)	136, 2647
FspBI	CTAG	5 cut(s)	167, 1116, 1401, 2579, 3060
GlaI	GCGC	1 cut(s)	2904
GsaI	CCCAGC	3 cut(s)	509, 2404, 3039
GsuI	CTGGAG	1 cut(s)	1725
HaeII	RGCGCY	1 cut(s)	2906
HaeIII	GGCC	5 cut(s)	269, 1181, 2477, 2963, 3124
HapII	CCGG	2 cut(s)	1887, 2478
HhaI	GCGC	1 cut(s)	2905
Hin6I	GCGC	1 cut(s)	2903
HinP1I	GCGC	1 cut(s)	2903
HincII	GTYRAC	1 cut(s)	1917
HindII	GTYRAC	1 cut(s)	1917
HindIII	AAGCTT	2 cut(s)	1031, 3023
HinfI	GANTC	6 cut(s)	67, 569, 1256, 2263, 2807, 2840
HpaII	CCGG	2 cut(s)	1887, 2478
HphI	GGTGA	6 cut(s)	340, 542, 644, 940, 1565, 1966
Hpy166II	GTNNAC	5 cut(s)	667, 1228, 1292, 1917, 2866
Hpy188I	TCNGA	9 cut(s)	442, 1261, 1867, 2168, 2233, 2249, 2543, 2731, 2940
Hpy8I	GTNNAC	5 cut(s)	667, 1228, 1292, 1917, 2866
HpyCH4III	ACNGT	4 cut(s)	52, 892, 2191, 2863
HpyCH4IV	ACGT	2 cut(s)	1375, 3004
HpyF3I	CTNAG	9 cut(s)	116, 414, 422, 441, 933, 1034, 1296, 2730, 2748
HpySE526I	ACGT	2 cut(s)	1375, 3004
HspAI	GCGC	1 cut(s)	2903
Ksp22I	TGATCA	3 cut(s)	330, 547, 1555
LmnI	GCTCC	3 cut(s)	131, 409, 770
MaeI	CTAG	5 cut(s)	167, 1116, 1401, 2579, 3060
MaeII	ACGT	2 cut(s)	1375, 3004
MaeIII	GTNAC	6 cut(s)	580, 901, 1001, 2171, 2329, 2702
MflI	RGATCY	2 cut(s)	917, 2249
MhlI	GDGCHC	7 cut(s)	11, 136, 1294, 1416, 1722, 2166, 2647
MlsI	TGGCCA	1 cut(s)	269
MluCI	AATT	7 cut(s)	188, 837, 1200, 1824, 2076, 2132, 2237
MluNI	TGGCCA	1 cut(s)	269
MlyI	GAGTC	1 cut(s)	2816
MmeI	TCCRAC	4 cut(s)	697, 757, 1135, 1890
Mox20I	TGGCCA	1 cut(s)	269
MroXI	GAANNNNTTC	3 cut(s)	66, 573, 1861
MscI	TGGCCA	1 cut(s)	269
MseI	TTAA	8 cut(s)	539, 840, 1218, 1521, 1539, 1679, 2063, 2529
MslI	CAYNNNNRTG	5 cut(s)	881, 1494, 1725, 1764, 2014
Msp20I	TGGCCA	1 cut(s)	269
MspA1I	CMGCKG	4 cut(s)	94, 380, 509, 2404
MspI	CCGG	2 cut(s)	1887, 2478
MspR9I	CCNGG	9 cut(s)	461, 468, 594, 1130, 1514, 1887, 2315, 2367, 3112
Mva1269I	GAATGC	4 cut(s)	870, 1164, 1191, 2880
MvaI	CCWGG	8 cut(s)	461, 468, 594, 1130, 1514, 2315, 2367, 3112
NciI	CCSGG	1 cut(s)	1887
NcoI	CCATGG	2 cut(s)	1149, 1445
NdeI	CATATG	2 cut(s)	2015, 3053
NlaIV	GGNNCC	6 cut(s)	133, 157, 218, 465, 943, 2660
NmeAIII	GCCGAG	1 cut(s)	2764
NmuCI	GTSAC	5 cut(s)	580, 901, 1001, 2329, 2702
NspI	RCATGY	3 cut(s)	1612, 2578, 2804
OliI	CACNNNNGTG	2 cut(s)	1494, 1764
PaeR7I	CTCGAG	1 cut(s)	143
PciI	ACATGT	2 cut(s)	1608, 2800
PctI	GAATGC	4 cut(s)	870, 1164, 1191, 2880
PdmI	GAANNNNTTC	3 cut(s)	66, 573, 1861
PfeI	GAWTC	5 cut(s)	67, 569, 1256, 2263, 2840
PflFI	GACNNNGTC	1 cut(s)	500
PfoI	TCCNGGA	2 cut(s)	466, 592
PleI	GAGTC	1 cut(s)	2815
PpsI	GAGTC	1 cut(s)	2815
PpuMI	RGGWCCY	1 cut(s)	2658
PscI	ACATGT	2 cut(s)	1608, 2800
Psp1406I	AACGTT	1 cut(s)	3004
Psp5II	RGGWCCY	1 cut(s)	2658
Psp6I	CCWGG	8 cut(s)	459, 466, 592, 1128, 1512, 2313, 2365, 3110
PspFI	CCCAGC	3 cut(s)	505, 2400, 3035
PspGI	CCWGG	8 cut(s)	459, 466, 592, 1128, 1512, 2313, 2365, 3110
PspN4I	GGNNCC	6 cut(s)	133, 157, 218, 465, 943, 2660
PspPPI	RGGWCCY	1 cut(s)	2658
PstNI	CAGNNNCTG	2 cut(s)	383, 1850
PsuI	RGATCY	2 cut(s)	917, 2249
PsyI	GACNNNGTC	1 cut(s)	500
PvuII	CAGCTG	4 cut(s)	94, 380, 509, 2404
RsaI	GTAC	8 cut(s)	827, 855, 1075, 1613, 2106, 2291, 2692, 2984
RsaNI	GTAC	8 cut(s)	826, 854, 1074, 1612, 2105, 2290, 2691, 2983
RseI	CAYNNNNRTG	5 cut(s)	881, 1494, 1725, 1764, 2014
SaqAI	TTAA	8 cut(s)	539, 840, 1218, 1521, 1539, 1679, 2063, 2529
ScaI	AGTACT	1 cut(s)	2692
SchI	GAGTC	1 cut(s)	2816
ScrFI	CCNGG	9 cut(s)	461, 468, 594, 1130, 1514, 1887, 2315, 2367, 3112
SduI	GDGCHC	7 cut(s)	11, 136, 1294, 1416, 1722, 2166, 2647
SfcI	CTRYAG	2 cut(s)	1842, 2716
Sfr274I	CTCGAG	1 cut(s)	143
SinI	GGWCC	7 cut(s)	155, 1309, 1442, 2658, 2833, 3077, 3090
SlaI	CTCGAG	1 cut(s)	143
SmiMI	CAYNNNNRTG	5 cut(s)	881, 1494, 1725, 1764, 2014
SmlI	CTYRAG	7 cut(s)	29, 143, 194, 524, 2551, 2792, 2911
SmoI	CTYRAG	7 cut(s)	29, 143, 194, 524, 2551, 2792, 2911
Sse9I	AATT	7 cut(s)	188, 837, 1200, 1824, 2076, 2132, 2237
SsiI	CCGC	8 cut(s)	120, 125, 963, 1416, 1440, 1510, 2463, 2933
SspI	AATATT	1 cut(s)	3130
SspMI	CTAG	5 cut(s)	167, 1116, 1401, 2579, 3060
StyD4I	CCNGG	9 cut(s)	459, 466, 592, 1128, 1512, 1885, 2313, 2365, 3110
StyI	CCWWGG	5 cut(s)	202, 1068, 1149, 1445, 2268
TaaI	ACNGT	4 cut(s)	52, 892, 2191, 2863
TaiI	ACGT	2 cut(s)	1378, 3007
TaqI	TCGA	8 cut(s)	144, 639, 1195, 1476, 1683, 2335, 2520, 2805
TaqII	GACCGA	1 cut(s)	1374
TasI	AATT	7 cut(s)	188, 837, 1200, 1824, 2076, 2132, 2237
TatI	WGTACW	3 cut(s)	825, 853, 2690
TfiI	GAWTC	5 cut(s)	67, 569, 1256, 2263, 2840
Tru1I	TTAA	8 cut(s)	539, 840, 1218, 1521, 1539, 1679, 2063, 2529
Tru9I	TTAA	8 cut(s)	539, 840, 1218, 1521, 1539, 1679, 2063, 2529
TscAI	CASTG	7 cut(s)	585, 664, 745, 1006, 1912, 1917, 2817
TseFI	GTSAC	5 cut(s)	580, 901, 1001, 2329, 2702
Tsp45I	GTSAC	5 cut(s)	580, 901, 1001, 2329, 2702
TspGWI	ACGGA	4 cut(s)	26, 849, 1091, 1970
TspRI	CASTG	7 cut(s)	585, 664, 745, 1006, 1912, 1917, 2817
Tth111I	GACNNNGTC	1 cut(s)	500
VneI	GTGCAC	1 cut(s)	1290
VpaK11BI	GGWCC	7 cut(s)	155, 1309, 1442, 2658, 2833, 3077, 3090
XapI	RAATTY	3 cut(s)	188, 1200, 2237
XbaI	TCTAGA	1 cut(s)	1115
XceI	RCATGY	3 cut(s)	1612, 2578, 2804
XcmI	CCANNNNNNNNNTGG	4 cut(s)	674, 973, 2275, 2401
XhoI	CTCGAG	1 cut(s)	143
XmnI	GAANNNNTTC	3 cut(s)	66, 573, 1861
XspI	CTAG	5 cut(s)	167, 1116, 1401, 2579, 3060
ZrmI	AGTACT	1 cut(s)	2692

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.