Rmu_sc0002276.1_g000006

3'-phosphoinositide-dependent protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002276.1
Physical Location & Seq
Forward (+)
20776 .. 21081
306 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002276.1_g000006.1.cds

Sequence Viewer

Length: 306 bp
atggtggtggtggtgctaatagtaatgttcagagagccaagaactttgcttgcagggctccccaagaaatttcaccatcaagactttgaattgggcaagatctatggcgttggttcatattcaaaggttgtgagagcaaggaagacggattcaggaattgcctacgcattaaagatcagggacaaaaaaaaagaggaagtgaaagaagaggcaggggtctacggcactgaacttcttggggtagaggaagtggtctacgacagtacggcaccgactgggggtgaagcaagtctggcattcccgtaa
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

11.13

Weight (kDa)

7.94

Isoelectric Point (pI)

25.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018136)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 268
AccI GTMKAC 2 cut(s) 219, 255
AcsI RAATTY 1 cut(s) 68
AfaI GTAC 1 cut(s) 265
AfiI CCNNNNNNNGG 1 cut(s) 278
AgsI TTSAA 2 cut(s) 89, 123
ApoI RAATTY 1 cut(s) 68
AsuHPI GGTGA 2 cut(s) 65, 293
BanI GGYRCC 1 cut(s) 268
BanII GRGCYC 1 cut(s) 60
BbsI GAAGAC 1 cut(s) 149
BccI CCATC 1 cut(s) 84
BceAI ACGGC 2 cut(s) 238, 282
BglII AGATCT 1 cut(s) 99
BmiI GGNNCC 2 cut(s) 59, 270
BmrI ACTGGG 1 cut(s) 285
BmuI ACTGGG 1 cut(s) 285
BpiI GAAGAC 1 cut(s) 149
Bsc4I CCNNNNNNNGG 1 cut(s) 278
Bse1I ACTGG 1 cut(s) 280
BseLI CCNNNNNNNGG 1 cut(s) 278
BseNI ACTGG 1 cut(s) 280
BshNI GGYRCC 1 cut(s) 268
BslFI GGGAC 1 cut(s) 194
BslI CCNNNNNNNGG 1 cut(s) 278
BsmFI GGGAC 1 cut(s) 194
BsmI GAATGC 1 cut(s) 296
Bsp1286I GDGCHC 1 cut(s) 60
Bsp143I GATC 2 cut(s) 99, 174
BspLI GGNNCC 2 cut(s) 59, 270
BspT107I GGYRCC 1 cut(s) 268
BsrI ACTGG 1 cut(s) 280
BssMI GATC 2 cut(s) 99, 174
Bst4CI ACNGT 1 cut(s) 263
Bst6I CTCTTC 1 cut(s) 201
BstC8I GCNNGC 1 cut(s) 51
BstKTI GATC 2 cut(s) 102, 177
BstMBI GATC 2 cut(s) 99, 174
BstMWI GCNNNNNNNGC 2 cut(s) 55, 293
BstV2I GAAGAC 1 cut(s) 149
BstX2I RGATCY 1 cut(s) 99
BstYI RGATCY 1 cut(s) 99
BtsIMutI CAGTG 1 cut(s) 225
Cac8I GCNNGC 1 cut(s) 51
Csp6I GTAC 1 cut(s) 264
CviJI RGCY 2 cut(s) 37, 58
CviKI_1 RGCY 2 cut(s) 37, 58
CviQI GTAC 1 cut(s) 264
DpnI GATC 2 cut(s) 101, 176
DpnII GATC 2 cut(s) 99, 174
Eam1104I CTCTTC 1 cut(s) 201
EarI CTCTTC 1 cut(s) 201
Eco24I GRGCYC 1 cut(s) 60
EcoT38I GRGCYC 1 cut(s) 60
FaiI YATR 2 cut(s) 105, 118
FaqI GGGAC 1 cut(s) 194
FblI GTMKAC 2 cut(s) 219, 255
FriOI GRGCYC 1 cut(s) 60
HinfI GANTC 1 cut(s) 149
HphI GGTGA 2 cut(s) 65, 293
Hpy166II GTNNAC 2 cut(s) 220, 256
Hpy188I TCNGA 1 cut(s) 32
Hpy188III TCNNGA 2 cut(s) 80, 153
Hpy8I GTNNAC 2 cut(s) 220, 256
HpyCH4III ACNGT 1 cut(s) 263
HpyCH4V TGCA 1 cut(s) 53
HpyF10VI GCNNNNNNNGC 2 cut(s) 55, 293
Kzo9I GATC 2 cut(s) 99, 174
LmnI GCTCC 1 cut(s) 63
LpnPI CCDG 6 cut(s) 39, 138, 163, 198, 261, 278
MalI GATC 2 cut(s) 101, 176
MboI GATC 2 cut(s) 99, 174
MboII GAAGA 2 cut(s) 154, 218
MflI RGATCY 1 cut(s) 99
MhlI GDGCHC 1 cut(s) 60
MluCI AATT 3 cut(s) 68, 89, 156
MnlI CCTC 3 cut(s) 187, 202, 238
MseI TTAA 1 cut(s) 170
Mva1269I GAATGC 1 cut(s) 296
MwoI GCNNNNNNNGC 2 cut(s) 55, 293
NdeII GATC 2 cut(s) 99, 174
NlaIV GGNNCC 2 cut(s) 59, 270
PctI GAATGC 1 cut(s) 296
PfeI GAWTC 1 cut(s) 149
PspN4I GGNNCC 2 cut(s) 59, 270
PsuI RGATCY 1 cut(s) 99
RsaI GTAC 1 cut(s) 265
RsaNI GTAC 1 cut(s) 264
SaqAI TTAA 1 cut(s) 170
Sau3AI GATC 2 cut(s) 99, 174
SduI GDGCHC 1 cut(s) 60
SetI ASST 1 cut(s) 129
Sse9I AATT 3 cut(s) 68, 89, 156
TaaI ACNGT 1 cut(s) 263
TasI AATT 3 cut(s) 68, 89, 156
TfiI GAWTC 1 cut(s) 149
Tru1I TTAA 1 cut(s) 170
Tru9I TTAA 1 cut(s) 170
TscAI CASTG 1 cut(s) 232
TspDTI ATGAA 1 cut(s) 105
TspGWI ACGGA 1 cut(s) 161
TspRI CASTG 1 cut(s) 232
XapI RAATTY 1 cut(s) 68
XmiI GTMKAC 2 cut(s) 219, 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.