Rmu_sc0002589.1_g000044

disease resistance protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002589.1
Physical Location & Seq
Reverse (-)
229160 .. 229910
751 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002589.1_g000044.1.cds

Sequence Viewer

Length: 564 bp
atggagaaacaagaaaatggaggtgaagatggcattgttgccaagaagaaggtatgtttctccattccttcctcttgcttctcttttggccaagtcaagcgagtagttcatcgccgtatggatattgctgtcaggataaaagaactaaatgaggagttcattttgattgctagtcaaaaacaaaattatagctttcaaaacctgaaaagaggcttggaacaacttgaaccaaaactttcttcccctgttgatatagtatttgaccctcttggtgagatcaaagttgccaaagccatcattgaaggtcgtggtagtactagtaccccaaattcaactgagttgcaaactcttctacaatgcatacatcaattgtttgaggaaaagaaattcctccttgttttagatcatgtgtggaatccaaatcttagtgggtggaaacaattaagcagatcattatttaacggggatataggcagtataatgttggtgacatcacaaaatgaggaggttgctatcatgatgggagcagtcgatcccatgatccatttgaaggagtttaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

187

Amino Acids

21.12

Weight (kDa)

6.91

Isoelectric Point (pI)

43.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021656)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 527, 535
AcoI YGGCCR 1 cut(s) 88
AcsI RAATTY 2 cut(s) 328, 386
AfaI GTAC 2 cut(s) 316, 322
AfiI CCNNNNNNNGG 1 cut(s) 550
AgsI TTSAA 5 cut(s) 197, 227, 302, 333, 550
AhlI ACTAGT 1 cut(s) 317
AjuI GAANNNNNNNTTGG 4 cut(s) 197, 223, 229, 255
AluBI AGCT 1 cut(s) 192
AluI AGCT 1 cut(s) 192
AlwI GGATC 2 cut(s) 527, 535
AoxI GGCC 1 cut(s) 88
ApoI RAATTY 2 cut(s) 328, 386
AsuHPI GGTGA 3 cut(s) 35, 284, 499
BalI TGGCCA 1 cut(s) 90
BccI CCATC 3 cut(s) 23, 302, 514
BceAI ACGGC 1 cut(s) 99
BcuI ACTAGT 1 cut(s) 317
BfaI CTAG 2 cut(s) 171, 318
BmcAI AGTACT 1 cut(s) 316
BsaXI ACNNNNNCTCC 1 cut(s) 545
Bsc4I CCNNNNNNNGG 1 cut(s) 550
BseLI CCNNNNNNNGG 1 cut(s) 550
BseMII CTCAG 1 cut(s) 327
BseRI GAGGAG 2 cut(s) 167, 518
BshFI GGCC 1 cut(s) 90
BslI CCNNNNNNNGG 1 cut(s) 550
BsnI GGCC 1 cut(s) 90
Bsp143I GATC 5 cut(s) 276, 403, 449, 532, 540
BspANI GGCC 1 cut(s) 90
BspCNI CTCAG 1 cut(s) 328
BspHI TCATGA 1 cut(s) 516
BspPI GGATC 2 cut(s) 527, 535
BssMI GATC 5 cut(s) 276, 403, 449, 532, 540
Bst6I CTCTTC 1 cut(s) 354
BstDEI CTNAG 2 cut(s) 336, 425
BstKTI GATC 5 cut(s) 279, 406, 452, 535, 543
BstMBI GATC 5 cut(s) 276, 403, 449, 532, 540
BsuRI GGCC 1 cut(s) 90
BtgZI GCGATG 1 cut(s) 95
CciI TCATGA 1 cut(s) 516
Csp6I GTAC 2 cut(s) 315, 321
CviAII CATG 3 cut(s) 407, 517, 538
CviJI RGCY 4 cut(s) 90, 192, 213, 293
CviKI_1 RGCY 4 cut(s) 90, 192, 213, 293
CviQI GTAC 2 cut(s) 315, 321
DdeI CTNAG 2 cut(s) 336, 425
DpnI GATC 5 cut(s) 278, 405, 451, 534, 542
DpnII GATC 5 cut(s) 276, 403, 449, 532, 540
EaeI YGGCCR 1 cut(s) 88
Eam1104I CTCTTC 1 cut(s) 354
EarI CTCTTC 1 cut(s) 354
EcoT22I ATGCAT 1 cut(s) 362
FaeI CATG 3 cut(s) 410, 520, 541
FatI CATG 3 cut(s) 406, 516, 537
FspBI CTAG 2 cut(s) 171, 318
HaeIII GGCC 1 cut(s) 90
Hin1II CATG 3 cut(s) 410, 520, 541
HinfI GANTC 1 cut(s) 415
HphI GGTGA 3 cut(s) 35, 284, 499
Hpy188III TCNNGA 2 cut(s) 133, 517
HpyAV CCTTC 4 cut(s) 43, 78, 296, 544
HpyCH4V TGCA 2 cut(s) 343, 360
HpyF3I CTNAG 2 cut(s) 336, 425
Hsp92II CATG 3 cut(s) 410, 520, 541
Kzo9I GATC 5 cut(s) 276, 403, 449, 532, 540
LmnI GCTCC 1 cut(s) 524
LpnPI CCDG 3 cut(s) 118, 215, 258
MaeI CTAG 2 cut(s) 171, 318
MaeIII GTNAC 1 cut(s) 487
MalI GATC 5 cut(s) 278, 405, 451, 534, 542
MboI GATC 5 cut(s) 276, 403, 449, 532, 540
MboII GAAGA 4 cut(s) 38, 58, 231, 341
MfeI CAATTG 1 cut(s) 368
MlsI TGGCCA 1 cut(s) 90
MluCI AATT 5 cut(s) 184, 328, 368, 386, 440
MluNI TGGCCA 1 cut(s) 90
MnlI CCTC 9 cut(s) 14, 82, 145, 203, 276, 370, 401, 496, 499
Mox20I TGGCCA 1 cut(s) 90
Mph1103I ATGCAT 1 cut(s) 362
MscI TGGCCA 1 cut(s) 90
MseI TTAA 3 cut(s) 443, 459, 558
Msp20I TGGCCA 1 cut(s) 90
MunI CAATTG 1 cut(s) 368
NdeII GATC 5 cut(s) 276, 403, 449, 532, 540
NlaIII CATG 3 cut(s) 410, 520, 541
NmuCI GTSAC 1 cut(s) 487
NsiI ATGCAT 1 cut(s) 362
PagI TCATGA 1 cut(s) 516
PfeI GAWTC 1 cut(s) 415
RsaI GTAC 2 cut(s) 316, 322
RsaNI GTAC 2 cut(s) 315, 321
SaqAI TTAA 3 cut(s) 443, 459, 558
Sau3AI GATC 5 cut(s) 276, 403, 449, 532, 540
ScaI AGTACT 1 cut(s) 316
SetI ASST 6 cut(s) 25, 54, 194, 204, 307, 510
SpeI ACTAGT 1 cut(s) 317
Sse9I AATT 5 cut(s) 184, 328, 368, 386, 440
SspMI CTAG 2 cut(s) 171, 318
TaqI TCGA 1 cut(s) 531
TasI AATT 5 cut(s) 184, 328, 368, 386, 440
TatI WGTACW 1 cut(s) 314
TfiI GAWTC 1 cut(s) 415
Tru1I TTAA 3 cut(s) 443, 459, 558
Tru9I TTAA 3 cut(s) 443, 459, 558
TseFI GTSAC 1 cut(s) 487
Tsp45I GTSAC 1 cut(s) 487
TspDTI ATGAA 2 cut(s) 98, 148
XapI RAATTY 2 cut(s) 328, 386
XspI CTAG 2 cut(s) 171, 318
ZrmI AGTACT 1 cut(s) 316
Zsp2I ATGCAT 1 cut(s) 362
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.