Rmu_sc0003731.1_g000003

disease resistance protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003731.1
OG0021656
Physical Location & Seq
Forward (+)
13495 .. 14247
753 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003731.1_g000003.1.cds

Sequence Viewer

Length: 753 bp
atggagaaacaagaaaatggaggtgaagatggcattgttgccaagaagaaggtatgtttctccattccttcctcttgcttctcttttggccaagtcaatcgagtagttcatcgccgtatggatattgctgtcaggataaaagaactaaatgaggagttcattttgattgctagtcaaaaacaaaattatagctttcaaaacctgaaaagagacttggaacaacttgaaccaaaactttcttcccctgttgatatagtatttggtcgggaatacgaaaagaatattttactacataagttgttgactgcaaattgtcatgaacttaggggtccccttatgatccccatgatagggatgcgaggaattggaaagacaactctttccaaactagtctataatgatgaaaaggtcaaggctcattttgacaagagagtatgggtctctgtctcagaccctcttggtgagatcaaagttgccaaagccatcattgaaggtcttggtagtactagtaccccaaattcaactgagttgcaaactcttctacaatgcatacatcaattgtttgaggaaaagaaattcctccttgttttagatcatgtgtggaatccaaatcttactgggtggaaacaattaagcagatctttatttaacggagatataggcagtataatattggtgacatcacaaaatgaggaggttgctatcatgatgggagcagtcgatcccatgatccatttgaaggagtttaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

250

Amino Acids

28.33

Weight (kDa)

8.27

Isoelectric Point (pI)

36.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021656)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0002589.1_g000044 Rmu_sc0003731.1_g000003 Rmu_sc0003731.1_g000012
rosa_rugosa Rorug02G0232800 Rorug02G0298300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 334, 716, 724
AcoI YGGCCR 1 cut(s) 88
AcsI RAATTY 2 cut(s) 517, 575
AfaI GTAC 2 cut(s) 505, 511
AfiI CCNNNNNNNGG 3 cut(s) 350, 351, 739
AgsI TTSAA 5 cut(s) 197, 227, 491, 522, 739
AhlI ACTAGT 2 cut(s) 388, 506
AjuI GAANNNNNNNTTGG 4 cut(s) 197, 223, 229, 255
AluBI AGCT 1 cut(s) 192
AluI AGCT 1 cut(s) 192
Alw26I GTCTC 3 cut(s) 204, 445, 451
AlwI GGATC 3 cut(s) 334, 716, 724
AoxI GGCC 1 cut(s) 88
ApoI RAATTY 2 cut(s) 517, 575
AspS9I GGNCC 1 cut(s) 329
AsuHPI GGTGA 3 cut(s) 35, 473, 688
AvaII GGWCC 1 cut(s) 329
BalI TGGCCA 1 cut(s) 90
BccI CCATC 3 cut(s) 23, 491, 703
BceAI ACGGC 1 cut(s) 99
BcoDI GTCTC 3 cut(s) 204, 445, 451
BcuI ACTAGT 2 cut(s) 388, 506
BfaI CTAG 3 cut(s) 171, 389, 507
BglII AGATCT 1 cut(s) 638
BmcAI AGTACT 1 cut(s) 505
Bme18I GGWCC 1 cut(s) 329
BmgT120I GGNCC 1 cut(s) 329
BmiI GGNNCC 2 cut(s) 330, 331
BmrI ACTGGG 1 cut(s) 627
BmsI GCATC 1 cut(s) 345
BmuI ACTGGG 1 cut(s) 627
BsaI GGTCTC 1 cut(s) 445
BsaXI ACNNNNNCTCC 1 cut(s) 734
Bsc4I CCNNNNNNNGG 3 cut(s) 350, 351, 739
Bse1I ACTGG 1 cut(s) 622
BseGI GGATG 1 cut(s) 360
BseLI CCNNNNNNNGG 3 cut(s) 350, 351, 739
BseMII CTCAG 2 cut(s) 462, 516
BseNI ACTGG 1 cut(s) 622
BseRI GAGGAG 2 cut(s) 167, 707
BshFI GGCC 1 cut(s) 90
BslFI GGGAC 1 cut(s) 315
BslI CCNNNNNNNGG 3 cut(s) 350, 351, 739
BsmAI GTCTC 3 cut(s) 204, 445, 451
BsmFI GGGAC 1 cut(s) 315
BsnI GGCC 1 cut(s) 90
Bso31I GGTCTC 1 cut(s) 445
Bsp143I GATC 6 cut(s) 339, 465, 592, 638, 721, 729
BspANI GGCC 1 cut(s) 90
BspCNI CTCAG 2 cut(s) 461, 517
BspHI TCATGA 2 cut(s) 316, 705
BspLI GGNNCC 2 cut(s) 330, 331
BspPI GGATC 3 cut(s) 334, 716, 724
BspTNI GGTCTC 1 cut(s) 445
BsrI ACTGG 1 cut(s) 622
BssMI GATC 6 cut(s) 339, 465, 592, 638, 721, 729
Bst6I CTCTTC 1 cut(s) 543
BstDEI CTNAG 3 cut(s) 323, 448, 525
BstF5I GGATG 1 cut(s) 360
BstKTI GATC 6 cut(s) 342, 468, 595, 641, 724, 732
BstMAI GTCTC 3 cut(s) 204, 445, 451
BstMBI GATC 6 cut(s) 339, 465, 592, 638, 721, 729
BstX2I RGATCY 1 cut(s) 638
BstYI RGATCY 1 cut(s) 638
BsuRI GGCC 1 cut(s) 90
BtgZI GCGATG 1 cut(s) 95
BtsCI GGATG 1 cut(s) 360
CciI TCATGA 2 cut(s) 316, 705
Cfr13I GGNCC 1 cut(s) 329
Csp6I GTAC 2 cut(s) 504, 510
CviAII CATG 5 cut(s) 317, 346, 596, 706, 727
CviJI RGCY 4 cut(s) 90, 192, 416, 482
CviKI_1 RGCY 4 cut(s) 90, 192, 416, 482
CviQI GTAC 2 cut(s) 504, 510
DdeI CTNAG 3 cut(s) 323, 448, 525
DpnI GATC 6 cut(s) 341, 467, 594, 640, 723, 731
DpnII GATC 6 cut(s) 339, 465, 592, 638, 721, 729
EaeI YGGCCR 1 cut(s) 88
Eam1104I CTCTTC 1 cut(s) 543
EarI CTCTTC 1 cut(s) 543
Eco31I GGTCTC 1 cut(s) 445
Eco47I GGWCC 1 cut(s) 329
EcoO109I RGGNCCY 1 cut(s) 329
EcoT22I ATGCAT 1 cut(s) 551
FaeI CATG 5 cut(s) 320, 349, 599, 709, 730
FalI AAGNNNNNCTT 2 cut(s) 625, 657
FaqI GGGAC 1 cut(s) 315
FatI CATG 5 cut(s) 316, 345, 595, 705, 726
FokI GGATG 1 cut(s) 367
FspBI CTAG 3 cut(s) 171, 389, 507
HaeIII GGCC 1 cut(s) 90
Hin1II CATG 5 cut(s) 320, 349, 599, 709, 730
HincII GTYRAC 1 cut(s) 303
HindII GTYRAC 1 cut(s) 303
HinfI GANTC 1 cut(s) 604
HphI GGTGA 3 cut(s) 35, 473, 688
Hpy166II GTNNAC 1 cut(s) 303
Hpy188I TCNGA 1 cut(s) 451
Hpy188III TCNNGA 4 cut(s) 133, 266, 317, 706
Hpy8I GTNNAC 1 cut(s) 303
HpyAV CCTTC 4 cut(s) 43, 78, 485, 733
HpyCH4V TGCA 3 cut(s) 308, 532, 549
HpyF3I CTNAG 3 cut(s) 323, 448, 525
Hsp92II CATG 5 cut(s) 320, 349, 599, 709, 730
KflI GGGWCCC 1 cut(s) 329
Kzo9I GATC 6 cut(s) 339, 465, 592, 638, 721, 729
LmnI GCTCC 1 cut(s) 713
LpnPI CCDG 4 cut(s) 118, 215, 258, 603
LweI GCATC 1 cut(s) 345
MaeI CTAG 3 cut(s) 171, 389, 507
MaeIII GTNAC 1 cut(s) 676
MalI GATC 6 cut(s) 341, 467, 594, 640, 723, 731
MboI GATC 6 cut(s) 339, 465, 592, 638, 721, 729
MboII GAAGA 4 cut(s) 38, 58, 231, 530
MfeI CAATTG 1 cut(s) 557
MflI RGATCY 1 cut(s) 638
MlsI TGGCCA 1 cut(s) 90
MluCI AATT 7 cut(s) 184, 310, 363, 517, 557, 575, 629
MluNI TGGCCA 1 cut(s) 90
MnlI CCTC 9 cut(s) 14, 82, 145, 353, 465, 559, 590, 685, 688
Mox20I TGGCCA 1 cut(s) 90
Mph1103I ATGCAT 1 cut(s) 551
MscI TGGCCA 1 cut(s) 90
MseI TTAA 3 cut(s) 632, 648, 747
Msp20I TGGCCA 1 cut(s) 90
MunI CAATTG 1 cut(s) 557
NdeII GATC 6 cut(s) 339, 465, 592, 638, 721, 729
NlaIII CATG 5 cut(s) 320, 349, 599, 709, 730
NlaIV GGNNCC 2 cut(s) 330, 331
NmuCI GTSAC 1 cut(s) 676
NsiI ATGCAT 1 cut(s) 551
PagI TCATGA 2 cut(s) 316, 705
PfeI GAWTC 1 cut(s) 604
PpuMI RGGWCCY 1 cut(s) 329
Psp5II RGGWCCY 1 cut(s) 329
PspN4I GGNNCC 2 cut(s) 330, 331
PspPI GGNCC 1 cut(s) 329
PspPPI RGGWCCY 1 cut(s) 329
PsuI RGATCY 1 cut(s) 638
RsaI GTAC 2 cut(s) 505, 511
RsaNI GTAC 2 cut(s) 504, 510
SaqAI TTAA 3 cut(s) 632, 648, 747
Sau3AI GATC 6 cut(s) 339, 465, 592, 638, 721, 729
Sau96I GGNCC 1 cut(s) 329
ScaI AGTACT 1 cut(s) 505
SetI ASST 7 cut(s) 25, 54, 194, 204, 411, 496, 699
SfaNI GCATC 1 cut(s) 345
SinI GGWCC 1 cut(s) 329
SpeI ACTAGT 2 cut(s) 388, 506
Sse9I AATT 7 cut(s) 184, 310, 363, 517, 557, 575, 629
SspI AATATT 2 cut(s) 283, 672
SspMI CTAG 3 cut(s) 171, 389, 507
TaqI TCGA 2 cut(s) 100, 720
TasI AATT 7 cut(s) 184, 310, 363, 517, 557, 575, 629
TatI WGTACW 1 cut(s) 503
TfiI GAWTC 1 cut(s) 604
Tru1I TTAA 3 cut(s) 632, 648, 747
Tru9I TTAA 3 cut(s) 632, 648, 747
TseFI GTSAC 1 cut(s) 676
Tsp45I GTSAC 1 cut(s) 676
TspDTI ATGAA 4 cut(s) 98, 148, 333, 417
TspGWI ACGGA 1 cut(s) 666
VpaK11BI GGWCC 1 cut(s) 329
XapI RAATTY 2 cut(s) 517, 575
XspI CTAG 3 cut(s) 171, 389, 507
ZrmI AGTACT 1 cut(s) 505
Zsp2I ATGCAT 1 cut(s) 551
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.