Rmu_sc0003731.1_g000012

disease resistance protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003731.1
Physical Location & Seq
Forward (+)
79663 .. 80079
417 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003731.1_g000012.1.cds

Sequence Viewer

Length: 417 bp
atgatccctatgatagggatgcgaggaattggaaagacaactctttccaaactagtctataatgatgaaaaggtcaaggctcattttgacaagagagtatgggtctctgtctcagaccctcttgatgagatcaaagttgccaaagccatcattgaaggtcttggtagtactagtaccccaaattcaaatgagttgcaaactcttctacaatgcatacatcaattgtttgagggaaagaaattcctccttgttttagatgatgtgtggaatccaaatcttagtgggtggaaacaactaagcagatctttatttaatggggatataggcactataatattggtgacatcacaaaatgaggaggttgctatcatgatgggagcagtctctagcatgatccatttgaaggagttgaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

138

Amino Acids

15.35

Weight (kDa)

6.83

Isoelectric Point (pI)

24.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021656)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 388
AcsI RAATTY 2 cut(s) 181, 239
AfaI GTAC 2 cut(s) 169, 175
AfiI CCNNNNNNNGG 2 cut(s) 14, 403
AgsI TTSAA 4 cut(s) 155, 186, 403, 412
AhlI ACTAGT 2 cut(s) 52, 170
Alw26I GTCTC 3 cut(s) 109, 115, 388
AlwI GGATC 1 cut(s) 388
ApoI RAATTY 2 cut(s) 181, 239
AsuHPI GGTGA 1 cut(s) 352
BccI CCATC 2 cut(s) 155, 367
BcoDI GTCTC 3 cut(s) 109, 115, 388
BcuI ACTAGT 2 cut(s) 52, 170
BfaI CTAG 3 cut(s) 53, 171, 387
BglII AGATCT 1 cut(s) 302
BmcAI AGTACT 1 cut(s) 169
BmsI GCATC 1 cut(s) 9
BsaI GGTCTC 1 cut(s) 109
BsaXI ACNNNNNCTCC 1 cut(s) 398
Bsc4I CCNNNNNNNGG 2 cut(s) 14, 403
BseGI GGATG 1 cut(s) 24
BseLI CCNNNNNNNGG 2 cut(s) 14, 403
BseMII CTCAG 1 cut(s) 126
BseRI GAGGAG 1 cut(s) 371
BslI CCNNNNNNNGG 2 cut(s) 14, 403
BsmAI GTCTC 3 cut(s) 109, 115, 388
Bso31I GGTCTC 1 cut(s) 109
Bsp143I GATC 4 cut(s) 3, 129, 302, 393
BspCNI CTCAG 1 cut(s) 125
BspHI TCATGA 1 cut(s) 369
BspPI GGATC 1 cut(s) 388
BspTNI GGTCTC 1 cut(s) 109
BssMI GATC 4 cut(s) 3, 129, 302, 393
Bst6I CTCTTC 1 cut(s) 207
BstDEI CTNAG 3 cut(s) 112, 278, 296
BstENI CCTNNNNNAGG 1 cut(s) 12
BstF5I GGATG 1 cut(s) 24
BstKTI GATC 4 cut(s) 6, 132, 305, 396
BstMAI GTCTC 3 cut(s) 109, 115, 388
BstMBI GATC 4 cut(s) 3, 129, 302, 393
BstX2I RGATCY 1 cut(s) 302
BstYI RGATCY 1 cut(s) 302
BtsCI GGATG 1 cut(s) 24
CciI TCATGA 1 cut(s) 369
Csp6I GTAC 2 cut(s) 168, 174
CviAII CATG 2 cut(s) 370, 391
CviJI RGCY 2 cut(s) 80, 146
CviKI_1 RGCY 2 cut(s) 80, 146
CviQI GTAC 2 cut(s) 168, 174
DdeI CTNAG 3 cut(s) 112, 278, 296
DpnI GATC 4 cut(s) 5, 131, 304, 395
DpnII GATC 4 cut(s) 3, 129, 302, 393
Eam1104I CTCTTC 1 cut(s) 207
EarI CTCTTC 1 cut(s) 207
Eco31I GGTCTC 1 cut(s) 109
EcoNI CCTNNNNNAGG 1 cut(s) 12
EcoT22I ATGCAT 1 cut(s) 215
FaeI CATG 2 cut(s) 373, 394
FaiI YATR 8 cut(s) 11, 60, 100, 215, 323, 332, 371, 392
FalI AAGNNNNNCTT 2 cut(s) 289, 321
FatI CATG 2 cut(s) 369, 390
FokI GGATG 1 cut(s) 31
FspBI CTAG 3 cut(s) 53, 171, 387
Hin1II CATG 2 cut(s) 373, 394
HinfI GANTC 1 cut(s) 268
HphI GGTGA 1 cut(s) 352
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 2 cut(s) 122, 370
HpyAV CCTTC 2 cut(s) 149, 397
HpyCH4V TGCA 2 cut(s) 196, 213
HpyF3I CTNAG 3 cut(s) 112, 278, 296
Hsp92II CATG 2 cut(s) 373, 394
Kzo9I GATC 4 cut(s) 3, 129, 302, 393
LmnI GCTCC 1 cut(s) 377
LweI GCATC 1 cut(s) 9
MaeI CTAG 3 cut(s) 53, 171, 387
MaeIII GTNAC 1 cut(s) 340
MalI GATC 4 cut(s) 5, 131, 304, 395
MboI GATC 4 cut(s) 3, 129, 302, 393
MboII GAAGA 1 cut(s) 194
MfeI CAATTG 1 cut(s) 221
MflI RGATCY 1 cut(s) 302
MluCI AATT 4 cut(s) 27, 181, 221, 239
MnlI CCTC 6 cut(s) 17, 129, 223, 254, 349, 352
Mph1103I ATGCAT 1 cut(s) 215
MseI TTAA 1 cut(s) 312
MunI CAATTG 1 cut(s) 221
NdeII GATC 4 cut(s) 3, 129, 302, 393
NlaIII CATG 2 cut(s) 373, 394
NmuCI GTSAC 1 cut(s) 340
NsiI ATGCAT 1 cut(s) 215
PagI TCATGA 1 cut(s) 369
PfeI GAWTC 1 cut(s) 268
PsuI RGATCY 1 cut(s) 302
RsaI GTAC 2 cut(s) 169, 175
RsaNI GTAC 2 cut(s) 168, 174
SaqAI TTAA 1 cut(s) 312
Sau3AI GATC 4 cut(s) 3, 129, 302, 393
ScaI AGTACT 1 cut(s) 169
SetI ASST 3 cut(s) 75, 160, 363
SfaNI GCATC 1 cut(s) 9
SpeI ACTAGT 2 cut(s) 52, 170
Sse9I AATT 4 cut(s) 27, 181, 221, 239
SspI AATATT 1 cut(s) 336
SspMI CTAG 3 cut(s) 53, 171, 387
TasI AATT 4 cut(s) 27, 181, 221, 239
TatI WGTACW 1 cut(s) 167
TfiI GAWTC 1 cut(s) 268
Tru1I TTAA 1 cut(s) 312
Tru9I TTAA 1 cut(s) 312
TseFI GTSAC 1 cut(s) 340
Tsp45I GTSAC 1 cut(s) 340
TspDTI ATGAA 1 cut(s) 81
XagI CCTNNNNNAGG 1 cut(s) 12
XapI RAATTY 2 cut(s) 181, 239
XspI CTAG 3 cut(s) 53, 171, 387
ZrmI AGTACT 1 cut(s) 169
Zsp2I ATGCAT 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.